Pan paniscus (bonobo) microRNA 887 (ENSPPAG00000017703.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (bonobo) microRNA 887 (ENSPPAG00000017703.1) URS000062DC91_9597

79 nucleotides
1 database (Ensembl)
Found in 7 other species
5 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GUGCAGAUCCUUGGGAGCCCUGUUAGACUCUGGAUUUUACACUUGGAGUGAACGGGCGCCAUCCCGAGGCUUUGCACAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 887 (ENSGGOG00000033445.2)
Homo sapiens microRNA hsa-mir-887 precursor
Pan troglodytes (chimpanzee) ptr-mir-887 (ENSPTRG00000033565.2)
Pongo abelii microRNA 887 (ENSPPYG00000022115.2)
Pongo pygmaeus microRNA ppy-mir-887 precursor

2D structure

Publications