v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (Northern white-cheeked gibbon) mir-7 microRNA precursor URS000062CFAD_61853

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGCCUAGUUCUGUGUGGAAGACUAGUGAUUUUGUUGUUUUUAGAUAACUAAAUCGACAACAAAUCACAGUCUGCCAUAUGGCACAGGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Fukomys damarensis (Damara mole-rat) mir-7 microRNA precursor
  2. Gorilla gorilla gorilla mir-7 microRNA precursor
  3. Heterocephalus glaber mir-7 microRNA precursor
  4. Homo sapiens mir-7 microRNA precursor
  5. Oryctolagus cuniculus mir-7 microRNA precursor
  6. Pan troglodytes (chimpanzee) mir-7 microRNA precursor
  7. Pongo abelii mir-7 microRNA precursor
 Publications