Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) snoRNA (ENSG00000201733.1) secondary structure diagram

Homo sapiens (human) snoRNA (ENSG00000201733.1) URS00006298DE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA43: SNORA43 is a small nucleolar RNA (snoRNA) that is overexpressed in lung cancer stem cells and is inversely associated with survival in non-small cell lung cancer (NSCLC) patients [1]. A SYBR green approach was used to measure the relative mRNA levels of various snoRNAs, including SNORA43, in lung cancer cells [2]. SNORA43, along with SNORA17, is hosted in the introns of the small nucleolar RNA host gene 7 (SNHG7) [3]. SNHG7 is a 3'UTR/bidirectional long non-coding RNA (lncRNA) that encodes smaller snoRNAs, including SNORA43 and SNORA17 [4]. In some tumour genomes, amplification of SNORA43 was observed [5]. Losses of the 3p21.1 region where SNORA26 is located and the 3p25.3 region where SNORA43 is located were also observed [5]. In a study evaluating clinical significance in NSCLC tissues, SNORA3 and SNORA43 were found to have high expression levels in tumour-initiating cells compared to non-tumour-initiating cells [6]. References: 1. PMC6629867 2. PMC7760958 3. PMC7244715 4. PMC3747266 5. PMC5423597 6. PMC4029979

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAUGCCUUCCGGAACAUGCCAGCACCGCAGAUGCUGGCAGUCUGCUGUGCCCGUGAUAUUGGGCAAAGAGGAAGUGGCUAUUUCUACACUUGGUGUUCAGAAACCAGUGAGCUCUAAGAAUGGUUUAUAGCCUGACAUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications