Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) snoRNA (ENSG00000212415.1) secondary structure diagram

Homo sapiens (human) snoRNA (ENSG00000212415.1) URS0000623764_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD77: SNORD77 is a C/D box small nucleolar RNA (snoRNA) encoded by the GAS5 gene. It is predicted to regulate the 2'O-methylation of rRNA, facilitating RNA folding and interaction with ribosomes [PMC8658237]. SNORD77 is also involved in the diagnosis of lung cancer, as its coexpression with SNORD66 improves sensitivity and specificity [PMC9005336]. Mutations in SNORD77 have been observed, including a 11-nt deletion in the 5'-terminal area and a 1-nt insertion in the C-box-adjacent area [PMC6856654]. These mutations affect the spatial structure of SNORD77 and its interaction with snoRNA-associated proteins, leading to dysfunction [PMC6856654]. The downregulation of SNORD77 in certain cell lines indicates its altered function due to mutations [PMC6856654]. The presence of mutations in SNORD77 has been confirmed through T7 endonuclease I assay [PMC6856654]. It has been observed that mutant SNORD77 is expressed at a reduced level compared to wild-type, while mutant U74 RNA is not detected at all [PMC6856654]. Overall, SNORD77 plays a role in rRNA methylation and has implications for cancer diagnosis. It is encoded within GAS5 gene along with other snoRNAs such as SNORD74, SNORD75, and others [PMC9598326] [PMC9219770].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUACUAUGAUGUUUGCAUAGUUCAGCAGAUUGAAUUAUGAAGAGAUCUACCAUUUGUCUGGUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications