Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Nestor notabilis tRNA secondary structure diagram

Nestor notabilis tRNA URS00006174C2_176057

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUCGUUAGUAUAGUGGUGAGUAUCCCCGCCUGUCACGCGGGAGACCGGGGUUCGAUUCCCCGACGGGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 141 other species

  1. Acanthisitta chloris tRNA
  2. Ailuropoda melanoleuca tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 6)
  3. Alosa alosa (allis shad) tRNA-Asp
  4. Amazona aestiva tRNA
  5. Amphibalanus amphitrite tRNA-Asp
  6. Anas platyrhynchos tRNA
  7. Anguilla anguilla (European eel) tRNA-Asp
  8. Anolis carolinensis tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  9. Apaloderma vittatum tRNA
  10. Aptenodytes forsteri tRNA
  11. Astyanax mexicanus (Mexican tetra) tRNA
  12. Ataeniobius toweri tRNA-Asp
  13. Balaenoptera acutorostrata scammoni tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 8)
  14. Balearica regulorum gibbericeps tRNA
  15. Bos taurus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 13)
  16. Callipepla squamata tRNA
  17. Callithrix jacchus tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 9)
  18. Camelus ferus (Wild Bactrian camel) tRNA
  19. Canis lupus familiaris tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 10)
  20. Antrostomus carolinensis tRNA
  21. Cariama cristata (red-legged seriema) tRNA
  22. Carlito syrichta tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 6)
  23. Cavia porcellus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 7)
  24. Ceratotherium simum simum tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 6)
  25. Chaetura pelagica tRNA
  26. Characodon lateralis tRNA-Asp
  27. Charadrius vociferus tRNA
  28. Chelonia mydas tRNA
  29. Chelydra serpentina (Common snapping turtle) tRNA-Asp
  30. Chlamydotis macqueenii tRNA
  31. Chlorocebus sabaeus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 8)
  32. Choloepus hoffmanni tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 5)
  33. Chrysemys picta bellii tRNA-Asp (GTC) (tRNA-Asp-GTC-2-1, tRNA-Asp-GTC-2-2)
  34. Ciona intestinalis tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 7)
  35. Ciona savignyi tRNA
  36. Colinus virginianus tRNA
  37. Colius striatus (speckled mousebird) tRNA
  38. Columba livia tRNA
  39. Corvus brachyrhynchos (American crow) tRNA
  40. Crenichthys baileyi tRNA-Asp
  41. Cricetulus griseus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 8)
  42. Cuculus canorus (common cuckoo) tRNA
  43. Dasypus novemcinctus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 9)
  44. Dipodomys ordii tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 13)
  45. Echinops telfairi tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  46. Egretta garzetta tRNA
  47. Eptesicus nilssonii tRNA-Asp
  48. Equus caballus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 6)
  49. Erinaceus europaeus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 9)
  50. Eschrichtius robustus tRNA-Asp
  51. Eurypyga helias tRNA
  52. Felis catus tRNA-Asp (GTC) (tRNA-Asp-GTC-3 1 to 7)
  53. Ficedula albicollis tRNA
  54. Fukomys damarensis tRNA
  55. Fulmarus glacialis tRNA
  56. Galendromus occidentalis (Western predatory mite) tRNA-Asp
  57. Gallus gallus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 8)
  58. Geospiza fortis tRNA-Asp (GTC) (tRNA-Asp-GTC-2-1, tRNA-Asp-GTC-2-2)
  59. Gorilla gorilla gorilla tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 8)
  60. Heterocephalus glaber tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 5)
  61. Homo sapiens tRNA-Asp (anticodon GTC) 2-1 (TRD-GTC2 1 to 11)
  62. Ictidomys tridecemlineatus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 6)
  63. Lamprotornis superbus tRNA-OTHER
  64. Larimichthys crocea tRNA
  65. Lepisosteus oculatus tRNA
  66. Leptosomus discolor tRNA
  67. Leptotrombidium deliense (Harvest mite) tRNA-Asp for anticodon GUC
  68. Lonchura striata domestica (Bengalese finch) tRNA
  69. Loxodonta africana tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 6)
  70. Macaca mulatta tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 9)
  71. Manacus vitellinus (golden-collared manakin) tRNA
  72. Marmota monax tRNA.Asp
  73. Megalops atlanticus (tarpon) tRNA-Asp
  74. Meleagris gallopavo tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 9)
  75. Melopsittacus undulatus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 4)
  76. Merops nubicus tRNA
  77. Mesitornis unicolor (brown roatelo) tRNA
  78. Mesocricetus auratus tRNA
  79. Microcebus murinus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 10)
  80. Monodelphis domestica tRNA-Asp (GTC) (tRNA-Asp-GTC-3 1 to 4)
  81. Mus caroli tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 8)
  82. Mus musculus castaneus tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 9)
  83. Mus musculus domesticus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 11)
  84. Mus musculus musculus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 9)
  85. Mus musculus tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 13, tRNA-Asp-GTC-2 1 to 14)
  86. Mus pahari tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 9)
  87. Mus spretus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 9)
  88. Mustela putorius furo tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 5)
  89. Myotis brandtii tRNA
  90. Myotis davidii tRNA
  91. Myotis lucifugus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 6)
  92. Neotoma lepida (desert woodrat) tRNA
  93. Nipponia nippon tRNA
  94. Nomascus leucogenys tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 6)
  95. Notamacropus eugenii tRNA-Asp (GTC) (tRNA-Asp-GTC-3-1)
  96. Nothobranchius furzeri tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 7)
  97. Ochotona princeps tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 12)
  98. Ophiophagus hannah tRNA
  99. Opisthocomus hoazin tRNA
  100. Oreochromis niloticus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 5)
  101. Ornithorhynchus anatinus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 10)
  102. Oryctolagus cuniculus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 18)
  103. Oryzias latipes tRNA-Asp (GTC) (tRNA-Asp-GTC-2-1)
  104. Otolemur garnettii tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 10)
  105. Ovis aries tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 8)
  106. Pan troglodytes tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 8)
  107. Papio anubis tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 9)
  108. Patagioenas fasciata monilis tRNA
  109. Pelobates cultripes (western spadefoot toad) tRNA.Asp
  110. Perca flavescens tRNA-Asp
  111. Perca fluviatilis tRNA-Asp
  112. Phaethon lepturus tRNA
  113. Phrynosoma platyrhinos tRNA-OTHER
  114. Dryobates pubescens tRNA
  115. Podarcis lilfordi tRNA.Asp
  116. Podiceps cristatus tRNA
  117. Poecilia formosa tRNA
  118. Pollicipes pollicipes tRNA-Asp
  119. Pongo abelii tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 7)
  120. Procavia capensis tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 8)
  121. Pterocles gutturalis tRNA
  122. Pteropus alecto tRNA
  123. Pygoscelis adeliae tRNA
  124. Rattus norvegicus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 18)
  125. Saimiri boliviensis boliviensis tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 7)
  126. Sarcophilus harrisii tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 5)
  127. Scleropages formosus tRNA
  128. Sorex araneus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 10)
  129. Struthio camelus australis tRNA
  130. Sus scrofa tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 13)
  131. Taeniopygia guttata tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 3)
  132. Takifugu rubripes tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1, tRNA-Asp-GTC-1-2)
  133. Tauraco erythrolophus (red-crested turaco) tRNA
  134. Tetraodon nigroviridis tRNA
  135. Tinamus guttatus tRNA
  136. Trichechus manatus latirostris tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 4)
  137. Tupaia chinensis (Chinese tree shrew) tRNA
  138. Tursiops truncatus tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 5)
  139. Vicugna pacos tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 6)
  140. Xenopus tropicalis tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 52)
  141. Xiphophorus maculatus tRNA
2D structure Publications