Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Apis mellifera (honey bee) ame-miR-263b-5p URS000061230B_7460

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ame-mir-263b: Ame-mir-263b, a significant miRNA found in Macrobrachium nipponense, was absent in a previous study by RJM [PMC3424160]. In a study by Ashby et al., Ame-mir-263b was used as a reference sequence [PMC5452642]. Ame-mir-263b was observed to be induced in G. mellonella during pupation, similar to its expression profiles in B. mori [PMC4156658]. It specifically showed induction in pupae but not pre-pupae and targeted mRNAs encoding dead box polypeptide 1 and cd27-binding protein isoform 1 [PMC4156658]. However, its predicted target contig 20004 was upregulated rather than downregulated during metamorphosis [PMC4156658]. Ame-mir-263b, along with aca-miR-30b-5p and cfa-miR-125a, may have a strong influence on sex-differentiation and sex-determination in M. nipponense [PMC5607309]. Among the three miRNAs studied, ame-mir-263b had the highest expression level in the androgenic gland [PMC5607309]. In the ovary, ame-mir-263b was up-regulated by 3.37-fold compared to control samples [PMC5607309]. A total of 11 differentially expressed genes (DEGs) predicted as target genes of ame-mir-263b were identified [PMC5607309].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUGGCACUGGAAGAAUUCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Nasonia giraulti ngi-miR-263b
  2. Nasonia longicornis nlo-miR-263b
  3. Tribolium castaneum (red flour beetle) tca-miR-263b-5p
Publications