Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ALG9 intronic transcript 1 (ALG9-IT1) URS000060D3B6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ALG9-IT1: ALG9-IT1 is a long non-coding RNA (lncRNA) that has been found to be significantly downregulated in liver tissues from patients with non-alcoholic fatty liver disease (NAFLD) compared to control samples [PMC9260751]. The expression levels of two other lncRNAs, LINC00240 and RBMS3-AS3, were found to be significantly upregulated in the liver tissues of NAFLD patients [PMC9260751]. The expression levels of LINC00240 and ALG9-IT1 were consistent with the results of bioinformatics analysis, while RBMS3-AS3 showed an opposite trend [PMC9260751]. These lncRNAs, including ALG9-IT1, may play a role in attenuating liver fibrosis in NAFLD by influencing the extracellular matrix through a competing endogenous RNA (ceRNA) network [PMC9260751]. In addition to NAFLD, ALG9-IT1 has also been found to be strongly correlated with the progression of esophageal carcinoma [PMC8486540]. Furthermore, ALG9-IT1 is expressed specifically in T-helper cell subtypes ThP, Th0, Th1 and Th2, while another lncRNA called CTD-2113 L7.1 is expressed in all T cells investigated [PMC4240855]. In conclusion, ALG9-IT1 is a downregulated lncRNA that may have functional roles in NAFLD and esophageal carcinoma. Its expression pattern suggests its involvement in liver fibrosis attenuation through the ceRNA network. Furthermore, its specific expression pattern in T-helper cell subtypes indicates its potential role in immune regulation. These findings highlight the potential importance of ALG9-IT1 as a biomarker or therapeutic target for various diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAACAAAAAAAAUGGGCUCUUUGGUUAUACUUUAAGGCAGAUUUAAAUCCAGUCUUUUGAUUUUUGAAUUGUAGAUGAUGUGGUUAUGAUCUCAGAUUUUGCAGUGUGAGAUAUUUAUAAAAUUGAGAGAAUAAAUUUAUUCUCUCUGGUUGUAAUUCAAGUCAUGUUACUUUAGCUUUUAGACCUAUGGGGCAGUAGACAGUUGGUGUUUUCAGGGAUAUAAACUGAGGACUCUCAAGCUAAAAAUAGUCACAGUAAAACAAUAUAUAUAACAUGAUCCAGAUCUUGUAAAGAAAAAUCAAUAUCUGCAGAGAAGUUCUGGGAUAUACACUAAUAGGCUGAUGGUGAUUUUCUUUGGGUCGAGACUGCAGUGAGUUUUGUUUUUUAUUUUUUUUUGAGUCAGAGUCUCGCUCUGUCUCCCAGCCUGGAGUGCAGUGGCGUGAUCUUGGCUCACAGACUGCAGUGAGUUGUGAUUUGCACUACUACACUCCAGCCCGGGUGACUGAGUGAGUCCCUGUCUAGAAAGAAAGAAAUAUCAGAAGGCAUUAUCACUUCACAACUGAAUAUUACAGUAGUAACUAGAGUGCUUACUUCAGCUUUUUCCUCCAACACUUUCUUGCCUCAUCCUCCGCAGCAUAGCUAGUAUAGGCCUCUCUUUCUAAGACCCUGUUUUUUAUCAUCUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications