Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-502 URS0000601CC4_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-502: Cfa-mir-502 is a microRNA that has been discovered to be overexpressed in canine mammary tumors (CMT) and is considered a diagnostic target for CMT [PMC9917093]. The role of cfa-mir-502 in CMT needs further exploration [PMC9917093]. Studies have shown that cfa-mir-502 is significantly upregulated in CMT compared to normal tissue [PMC9917093]. In a study comparing Sertoli cell tumors and normal testis, cfa-mir-502 was one of the top five microRNAs with a fold change cut-off of >2, indicating its potential role in Sertoli cell tumors [PMC10135127]. Among these top five microRNAs, cfa-miR-27b, cfa-miR-20a, and cfa-miR-93 were highly expressed in Sertoli cell tumors, while cfa-mir-502 and cfa-miR-500 were less expressed [PMC10135127]. Furthermore, the conservation of miR-502 has been observed across multiple animal species including cow (Bos taurus), dog (Canis lupus familiaris), horse (Equus caballus), gorilla (Gorilla gorilla), rhesus monkey (Macaca mulatta), rabbit (Oryctolagus cuniculus), and Bornean orangutan (Pongo pygmaeus) [PMC10144852]. These findings suggest the potential importance of miR-502 across different species.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUGCACCUGGGCAAGGAUUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Bos taurus (cattle) bta-miR-502a
  2. Equus caballus (horse) eca-miR-502-3p
  3. Gorilla gorilla gorilla ggo-miR-502a (MIR502A)
  4. Gorilla gorilla (western gorilla) ggo-miR-502a
  5. Homo sapiens hsa-miR-502-3p
  6. Macaca mulatta mml-miR-502-3p
  7. Oryctolagus cuniculus ocu-miR-502a-3p
  8. Pongo pygmaeus ppy-miR-502-3p
Publications