v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) HIF1A antisense RNA 3 (HIF1A-AS3) URS0000600EEF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HIF1A-AS3: HIF1A-AS3 is a long non-coding RNA (lncRNA) that is induced and stabilizes HIF1A binding in hypoxia response elements (HRE) in cancer cells [PMC9845402]. It assembles the HIF1A transactivation complex and enhances the expression of HIF1α target genes [PMC9845402]. HIF1A-AS3, along with HIF1A and HIF1A-AS1, is upregulated in Li-infected macrophages [PMC9845402]. It is also identified as one of the 16 prognostic cuproptosis-related lncRNAs, which are associated with cuproptosis-related diseases [PMC9434888]. In a study of hypoxia-related genes, HIF1A-AS3 was found to be upregulated along with other known hypoxia-related genes [PMC7083003]. It was also suggested that HIF1A-AS3 may act as an upstream regulator of hypoxia responses in progressive multiple sclerosis patients [PMC7083003]. Additionally, the involvement of HIF1A-AS3 in neurological diseases was demonstrated, highlighting its potential role in neuroprotection [PMC7083003]. Furthermore, it was found that lncRNA HIF1A-AS3 affects the expression of DNMT3a through downregulation of miR-129-5p [PMC8789170]. References: [PMC9845402] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9845402/ [PMC9434888] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9434888/ [PMC7083003] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7083003/ [PM8789170] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8789170/

Targeting miRNAs 2 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCAUGUAGCGCCAGCCACACCAGGAACAGAAGGGUGCCGGGUACCUUCCGCAUGCUUGGUAUUCUCCCCGCGGGGCUCUGACCGCUGCCGCUCUCAGGCACCUGUCUUUCCUCUCCGUCCCAGAAUGGAGCCAAGACAAGGGAAUAAACGAAAUUCAAUAGUACACGGAGAUCGGGUGUCUGGGCAGCGUCUUGGAAAAACUAUCCACUACAGUACAGGUCAAGUGAAGUUCUUCUGCUGAUAUGUUCUGCUACUGCAUAAGAGACGGAAUCUAUGUUGCCUCGACUGGUCCUGAACUCCUGGGCUAAAGCGAUCCUUCUGCCUUGGCCUCCCAAAGUGCGAGGAUUAUAGGUGUGAGCCACCCAACCUGGCCUUUGCCAGUAUUUUUAAAUCCAAACACCUAUGCAUGGUGCUUACUAAUAACACAGUGGUAUUCUAAACAUUUUUCACCUAUUAUUUAAUCUUUAUUAUUAUCACCAUGUUACAGAUAAGGACCCUGGCUAAAUAGCUUACCCAACAUUACUCCGUUAAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications