Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 27 (SNORA27) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 27 (SNORA27) URS00005F1DD0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA27: SNORA27 is a small nucleolar RNA (snoRNA) that has been studied in various contexts. It is one of the snoRNAs that are part of a signature, which includes SNORA12, SNORA22, SNORA27, SNORA56, SNORA64, SNORA69, SNORA70, SNORA74A, SNORA80, SNORA84, SNORD1A, SNORD1B, SNORD8, SNOR18, SNORD30,SNORD32A ,SNORD34 ,SNORD105B ,SNORD110 and SCARNA8 [PMC8629011]. In the context of STS (soft tissue sarcoma), the expression of ACA39 and two snoRNAs (SNORA11C and 27) increased while the U13 paralog on chromosome 1 showed decreased expression [PMC4491207]. In another study on ageing and osteoarthritis (OA), several snoRNAs including ACA39 and two others (SNOR36 and 27) were found to target helix 68 modifications [PMC7326970]. Additionally in exosomes derived from A33-Exos cells and Ep-CAM-Exos cells several snoRNAs were found to be overexpressed or enriched including snoRNA18,snoRNA27,snoRNA57,snoRNA62,snoRNA68,snoRNA70,snoRNA77,SNOR23,SNOU13 in A33-Exos cells while snoRNA14B,snoR31,SNO77,U3,SNOU13 were enriched in Ep-CAM-Exos cells [PMC7461500]. In proliferating normal B-cells and proliferating CLL cells eight snoRNAs including SNO12,SNO22,SNO27,SNO56,SNO70 ,SND8 ,SND105B,and SCA8 were upregulated and two snoRNAs (SNO80 and SND1A) were downregulated, suggesting their potential role in proliferation [PMC9219770]. Finally, in a study where DEGs (differentially expressed genes) were identified, SNORA27 was one of the four DEGs of unclear function and/or showed borderline differences in gene expression [PMC6428308].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACCCCCUUUUCACUUUGCCAGUUGGACUUAUGUCUUUAUUGGUCAUUCAAGUGGGGCAAAGGAAAUAUCCUUUUAAAACUCAGGCAAACUGGGUGUUUGUCUGUAUCCUGUCAGAGGAAACAAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications