Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Haplochromis burtoni (Burton's mouthbrooder) abu-miR-16a URS00005EFDB6_8153

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCACGUAAAUAUUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Bos taurus bta-miR-16b
  2. Homo sapiens (human) microRNA mir-16-3
  3. Mus musculus Mus_musculus piRNA piR-mmu-72445
  4. Neolamprologus brichardi (lyretail cichlid) nbr-miR-16a
  5. Oryzias latipes (Japanese medaka) ola-miR-16
  6. Pundamilia nyererei pny-miR-16a
  7. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62986
  8. Tursiops truncatus miR-16
  9. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-2450437