Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-222a URS00005D117C_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-222a: Gga-mir-222a is a microRNA that has been studied in relation to differential expression between two breeds of hens, Hy-line and Lohmann [PMC8390279]. A DEGSeq analysis using the R software environment identified 10 miRNAs that were significantly differentially expressed between the two breeds [PMC8390279]. Among these, gga-mir-222a was one of the miRNAs that showed significantly higher expression levels in Hy-line hens compared to Lohmann hens, with a log2 (fold change) > 1 [PMC8390279]. Additionally, gga-mir-222a was found to have an impact on the concentration of methionine in the medium [PMC8390279]. When gga-mir-222a was added, there was a significant increase (38.71%) in methionine concentration compared to the blank [PMC8390279]. These findings suggest that gga-mir-222a may play a role in regulating gene expression and metabolic processes related to methionine metabolism [PMC8390279]. Further research is needed to fully understand the functional significance of gga-mir-222a and its potential implications for breed-specific differences in hens [PMC8390279].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUACAUCUGGCUACUGGGUCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 54 other species

  1. Alligator mississippiensis ami-miR-222a-3p
  2. Anolis carolinensis Aca-Mir-221-P1a_3p (mature (guide))
  3. Ateles geoffroyi (black-handed spider monkey) age-miR-222
  4. Bos taurus Bta-Mir-221-P1a_3p (mature (guide))
  5. Callithrix jacchus Callithrix_jacchus piRNA piR-cja-142392
  6. Callorhinchus milii (elephant shark) Cmi-Mir-221-P1a_3p (mature (co-guide))
  7. Canis lupus familiaris Cfa-Mir-221-P1a_3p (mature (guide))
  8. Capra hircus chi-miR-222-3p
  9. Cavia porcellus cpo-miR-222-3p
  10. Cervus elaphus (red deer) cel-miR-222
  11. Chrysemys picta bellii Cpi-Mir-221-P1a_3p (mature (guide))
  12. Columba livia cli-miR-222a-3p
  13. Danio rerio (zebrafish) dre-miR-222a-3p
  14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-222-3p
  15. Daubentonia madagascariensis (aye-aye) dma-miR-222
  16. Drosophila erecta Drosophila_erecta piRNA piR-der-87848
  17. Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-21071703
  18. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-221-P1a_3p (mature (guide))
  19. Gadus morhua (Atlantic cod) Gmo-Mir-221-P1a1_3p (mature (guide))
  20. Gekko japonicus Gja-Mir-221-P1a_3p (mature (guide))
  21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-222
  22. Homo sapiens (human) Hsa-Mir-221-P1a_3p (mature (guide))
  23. Latimeria chalumnae Lch-Mir-221-P1a_3p (mature (guide))
  24. Lepisosteus oculatus (spotted gar) Loc-Mir-221-P1a_3p (mature (guide))
  25. Macaca mulatta (Rhesus monkey) Mml-Mir-221-P1a_3p (mature (guide))
  26. Maylandia zebra (zebra mbuna) mze-miR-222
  27. Microcaecilia unicolor Mun-Mir-221-P1a_3p (mature (guide))
  28. Microcebus murinus (gray mouse lemur) mmr-miR-222
  29. Monodelphis domestica mdo-miR-222a
  30. Monopterus albus (swamp eel) Mal-Mir-221-P1a1_3p (mature (guide))
  31. Mus musculus (house mouse) Mmu-Mir-221-P1a_3p (mature (guide))
  32. Neolamprologus brichardi (lyretail cichlid) nbr-miR-222
  33. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-222
  34. Ophiophagus hannah (king cobra) oha-miR-222a-3p
  35. Oreochromis niloticus oni-miR-222
  36. Ornithorhynchus anatinus (platypus) Oan-Mir-221-P1a_3p (mature (guide))
  37. Oryctolagus cuniculus ocu-miR-222-3p
  38. Otolemur garnettii (small-eared galago) oga-miR-222
  39. Pan paniscus ppa-miR-222
  40. Papio hamadryas pha-miR-222
  41. Pundamilia nyererei pny-miR-222
  42. Python bivittatus pbv-miR-222a-3p
  43. Rattus norvegicus (Norway rat) Rno-Mir-221-P1a_3p (mature (guide))
  44. Salmo salar ssa-miR-222a-3p
  45. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-221-P1a_3p (mature (guide))
  46. Scyliorhinus torazame (cloudy catshark) Sto-Mir-221-P1a_3p (mature (co-guide))
  47. Sphenodon punctatus (tuatara) Spt-Mir-221-P1a_3p (mature (guide))
  48. Sus scrofa ssc-miR-222
  49. Taeniopygia guttata (zebra finch) tgu-miR-222-3p
  50. Takifugu rubripes (torafugu) fru-miR-222
  51. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-222
  52. Tor tambroides (Thai mahseer) miR-222a-3p
  53. Xenopus laevis (African clawed frog) Xla-Mir-221-P1a4_3p (mature (guide))
  54. Xenopus tropicalis xtr-miR-222
Publications