Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mycobacterium marinum M signal recognition particle RNA secondary structure diagram

Mycobacterium marinum M signal recognition particle RNA URS00005C64FE_216594

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGACCCCGCGCACCCGACAGAGCCCAUUGACCCUUGCUGCCUUCCGGCCCUGGGGGAGUUCACAGGAUAGACGCCGCGCGGGGUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Mycobacterium ulcerans Agy99 signal recognition particle RNA
2D structure