Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Manihot esculenta (cassava) mes-miR390b URS00005C2DB4_3983

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCUCAGGAGGGAUAGCGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 38 other species

  1. Aegilops tauschii ata-miR390-5p
  2. Amborella trichopoda atr-miR390.2
  3. Ananas comosus (pineapple) miR390
  4. Arabidopsis lyrata (lyrate rockcress) aly-miR390a-5p
  5. Arabidopsis thaliana (thale cress) ath-miR390b-5p
  6. Asparagus officinalis (garden asparagus) aof-miR390
  7. Brachypodium distachyon (stiff brome) bdi-miR390a-5p
  8. Brassica napus (rape) bna-miR390c
  9. Brassica rapa (field mustard) bra-miR390-5p
  10. Camelina sativa cas-miR390b
  11. Carica papaya (papaya) cpa-miR390a
  12. Citrus sinensis csi-miR390a-5p
  13. Corchorus capsularis sRNA CCACVL1_11672
  14. Corchorus olitorius aly-miR390a-
  15. Cucumis melo (muskmelon) cme-miR390c
  16. Fragaria vesca subsp. vesca fve-miR390b
  17. Glycine max gma-miR390f
  18. Gossypium hirsutum ghr-miR390b
  19. Helianthus annuus (common sunflower) ath-miR390a-5p
  20. Helianthus exilis hex-miR390a
  21. Linum usitatissimum (flax) lus-miR390d
  22. Lotus japonicus lja-miR390b-5p
  23. Malus domestica mdm-miR390a
  24. Medicago truncatula mtr-miR390
  25. Nicotiana tabacum nta-miR390c
  26. Oryza sativa (Asian cultivated rice) osa-miR390-5p
  27. Oryza sativa Japonica Group microRNA osa-miR390-5p
  28. Physcomitrium patens ppt-miR390b
  29. Picea abies pab-miR390a
  30. Populus tomentosa Pto-miR390b
  31. Populus trichocarpa (black cottonwood) ptc-miR390b
  32. Prunus persica (peach) ppe-miR390
  33. Ricinus communis (castor bean) rco-miR390a
  34. Solanum lycopersicum sly-miR390b-5p
  35. Sorghum bicolor sbi-miR390
  36. Theobroma cacao (cacao) tcc-miR390a
  37. Vitis vinifera (wine grape) vvi-miR390
  38. Zea mays (maize) zma-miR390b-5p
Publications