Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) HAO2 intronic transcript 1 (HAO2-IT1) URS00005B433E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HAO2-IT1: HAO2-IT1 is a less studied long non-coding RNA (lncRNA) that requires further investigation to understand its functions in hepatocellular carcinoma (HCC) and other tumors [PMC8321115]. In a study, HAO2-IT1 was found to be one of the differentially expressed lncRNAs (DElncRNAs) that showed statistical significance in predicting overall survival (OS) [PMC8321115]. However, there is a lack of literature on HAO2-IT1 in tumorigenesis [PMC9680297]. HAO2-IT1 was found to interact with MT-RNR2 [PMC9680297]. In another study, the subcellular localization of various lncRNAs was determined, and it was found that HAO2-IT1 is located in the cytoplasm [PMC9680297]. Additionally, this study showed that HAO2-IT1 was downregulated in osteosarcoma (OS) samples compared to normal bone tissues [PMC9680297]. Another study also confirmed the downregulation of HAO2-IT1 in OS samples compared to normal bone tissues [PMC9680297].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAUGAAGUGCCAGAUAGGAUGGGAAUGGAAGAUAUCGUGGAAGCCAACUAUGAGUUUGCAAGCUUUGCCUUCUUGAGGAUGGAGGAUCGCUGUAGAGGAGGAAACAAAGCUGGAGGGUCACAUACCAGCUCUUCAAUCCUUGGCCUAGAAUUCACACCUGCUAUUCCCACUCCCAGGCCAUUGGCCAGAAGAACUAGUCACAGAGCCAUGCCUGUAUUUAAGCAACAGCGAAAUGUUAAGCAUGUGGGGAGCAGUAUAUGCCUCCGCCACCCUGGCUGAGAGUGUGUGUCAAUAAACCUUCUUGGAUAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes (chimpanzee) sense intronic
Publications