Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-658 URS00005A1F52_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-658: Hsa-mir-658 is a microRNA that has been identified in the colorectal microRNAome and has now been reported in the melanoma microRNAome as well [PMC4516543]. It is one of the miRNAs that is significantly downregulated in melanoma-derived mesenchymal stromal cells (M-MSCs) compared to amniotic fluid MSCs (AF-MSCs), particularly in relation to cell cycle regulation [PMC9319258]. This miRNA has also been found to have a lower abundance in clinical samples of Johne's disease compared to controls and shows statistically significant differential abundance across different experimental cases [PMC7125074]. In breast cancer research, hsa-mir-658 is suggested to function as a molecular sponge, potentially regulating the protein expression of target gene KCNQ4 and influencing cell proliferation and migration [PMC9976483]. Additionally, hsa-mir-658 has been identified as upregulated across various diseases without being downregulated in others, indicating its potential role as a biomarker [PMC4268797]. It also appears to be involved in diverse biological processes given its expression derived from various tissues of origin [PMC3117799] and is among the differentially expressed miRNAs potentially targeted by circ_0001789 [PMC9901162]. Lastly, hsa-mir-658 has been selected as part of an accurate prognostic predictor batch for certain diseases [PMC9241030].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCGGAGGGAAGUAGGUCCGUUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Relationships

Molecular Relationships

Publications