Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-658 URS00005A1F52_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-658: Hsa-mir-658 is a microRNA that has been reported to be part of the colorectal microRNAome but has not yet been demonstrated as part of the melanoma microRNAome [PMC4516543]. In a study comparing different types of mesenchymal stem cells (MSCs), it was found that hsa-mir-658 was significantly downregulated in melanoma-derived MSCs compared to amniotic fluid-derived MSCs [PMC9319258]. Another study found that hsa-mir-658 showed lower abundance in clinical samples of a certain disease compared to controls [PMC7125074]. BC069792, a specific gene, was found to bind to hsa-mir-658 and act as a molecular sponge, up-regulating the protein expression of the target gene KCNQ4 and inhibiting breast cancer [PMC9976483]. Hsa-mir-658 was also found to be upregulated in 11 diseases [PMC4268797]. It has been suggested that non-hematopoietically derived miRNAs, including hsa-mir-658, can enter and persist in circulation [PMC3117799]. In another study, hsa-mir-658 was identified as one of the top differentially expressed miRNAs associated with a certain condition [PMC7487708]. Hsa-mir-658 was also one of the three miRNAs identified as potential targets for circ_0001789 [PMC9901162]. Finally, in a prognostic prediction model for a specific disease, hsa-mir-658 was one of six miRNAs selected as an accurate predictor [PMC9241030].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCGGAGGGAAGUAGGUCCGUUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pongo pygmaeus ppy-miR-658
Publications