Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Myotis lucifugus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 8) secondary structure diagram

Myotis lucifugus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 8) URS000059D2BF_59463

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCUCUGUGGCGCAAUCGGUUAGCGCGUUCGGCUGUUAACCGAAAGGUUGGUGGUUCGAGCCCACCCAGGGACG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 201 other species

  1. Acanthaster planci (Crown-of-thorns starfish) tRNA-Asn
  2. Acanthisitta chloris tRNA
  3. Acinetobacter baumannii tRNA-Asn
  4. Actinia tenebrosa (Australian red waratah sea anemone) tRNA-Asn
  5. Aestuariibacter sp. tRNA-Asn
  6. Ailuropoda melanoleuca tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 11)
  7. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
  8. Albula goreensis tRNA-Asn
  9. Alligator mississippiensis tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 4)
  10. Alligator sinensis (Chinese alligator) tRNA
  11. Alosa alosa (allis shad) tRNA-Asn
  12. Amazona aestiva tRNA
  13. Ameiurus melas tRNA-Asn
  14. Anas platyrhynchos tRNA
  15. Anguilla anguilla tRNA-Asn
  16. Anolis carolinensis tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 6)
  17. Apaloderma vittatum tRNA
  18. Aplysia californica tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 7)
  19. Aptenodytes forsteri (emperor penguin) tRNA
  20. Astyanax mexicanus tRNA
  21. Ataeniobius toweri tRNA-Asn
  22. Balaenoptera acutorostrata scammoni tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 13)
  23. Balearica regulorum gibbericeps tRNA
  24. Biomphalaria glabrata tRNA tRNA-Asn
  25. Biomphalaria pfeifferi tRNA-Asn
  26. Bos taurus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 16)
  27. Branchiostoma floridae tRNA-Asn (GTT) (tRNA-Asn-GTT-2 1 to 7)
  28. Callipepla squamata (scaled quail) tRNA
  29. Callithrix jacchus tRNA-Asn (GTT) (tRNA-Asn-GTT-4 1 to 7)
  30. Callorhinchus milii tRNA-Asn (GTT) (tRNA-Asn-GTT-2-1)
  31. Calypte anna (Anna's hummingbird) tRNA
  32. Camelus ferus tRNA
  33. Canis lupus familiaris tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 6)
  34. Antrostomus carolinensis tRNA
  35. Cariama cristata (red-legged seriema) tRNA
  36. Carlito syrichta tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 3)
  37. Cathartes aura tRNA
  38. Cavia porcellus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 6)
  39. Ceratotherium simum simum tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 11)
  40. Chaetura pelagica tRNA
  41. Characodon lateralis tRNA-Asn
  42. Charadrius vociferus tRNA
  43. Chelonia mydas (green seaturtle) tRNA
  44. Chelydra serpentina (Common snapping turtle) tRNA-Asn
  45. Chlamydotis macqueenii tRNA
  46. Chlorocebus sabaeus tRNA-Asn (GTT) (tRNA-Asn-GTT-2 1 to 8)
  47. Choloepus hoffmanni tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 6)
  48. Chrysemys picta bellii tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 5)
  49. Ciona intestinalis tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 7)
  50. Colinus virginianus (northern bobwhite) tRNA
  51. Colius striatus tRNA
  52. Columba livia tRNA
  53. Crassostrea angulata (Portuguese oyster) transfer RNA asparagine (anticodon GUU)
  54. Crassostrea gigas (Pacific oyster) tRNA-Asn for anticodon GUU
  55. Crassostrea virginica tRNA-Asn
  56. Crenichthys baileyi tRNA-Asn
  57. Cricetulus griseus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 11)
  58. Cuculus canorus tRNA
  59. Danionella translucida tRNA-Asn
  60. Danio rerio tRNA-Asn (GTT) (tRNA-Asn-GTT-2 1 to 10)
  61. Dasypus novemcinctus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 11)
  62. Dipodomys ordii tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 11)
  63. Dreissena polymorpha (Zebra mussle) transfer RNA asparagine (anticodon GUU)
  64. Echinops telfairi tRNA-Asn (GTT) (tRNA-Asn-GTT-2 1 to 3)
  65. Egretta garzetta tRNA
  66. Eptesicus nilssonii tRNA-Asn
  67. Equus caballus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 8)
  68. Erinaceus europaeus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 6)
  69. Eschrichtius robustus tRNA-Asn
  70. Eurypyga helias (sunbittern) tRNA
  71. Felis catus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 17)
  72. Ficedula albicollis tRNA
  73. Fukomys damarensis tRNA
  74. Fulmarus glacialis tRNA
  75. Gallus gallus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 6)
  76. Gavia stellata tRNA
  77. Geospiza fortis tRNA-Asn (GTT) (tRNA-Asn-GTT-2-1, tRNA-Asn-GTT-2-2)
  78. Gigantopelta aegis (Deep sea snail) tRNA-Asn
  79. Gorilla gorilla gorilla tRNA-Asn (GTT) (tRNA-Asn-GTT-3 1 to 9)
  80. Haliaeetus albicilla tRNA
  81. Haliotis rubra (Blacklip abalone) tRNA-Asn
  82. Haliotis rufescens tRNA-Asn
  83. Heterocephalus glaber tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 6)
  84. Homo sapiens (human) tRNA-Asn (anticodon GTT) 2-1 (TRN-GTT2 1 to 8)
  85. Ictidomys tridecemlineatus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 6)
  86. Lamprotornis superbus tRNA-OTHER
  87. Larimichthys crocea tRNA
  88. Latimeria chalumnae tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 3)
  89. Lepisosteus oculatus tRNA
  90. Leptosomus discolor tRNA
  91. Limnoperna fortunei (Golden mussle) misc RNA ENSLFOG00000068275.1
  92. Lineus longissimus (Bootlace worm) misc RNA ENSLLNG00015024783.1
  93. Lingula anatina tRNA-Asn
  94. Lonchura striata domestica tRNA
  95. Loxodonta africana tRNA-Asn (GTT) (tRNA-Asn-GTT-2 1 to 12)
  96. Macaca mulatta tRNA-Asn (GTT) (tRNA-Asn-GTT-3-1, tRNA-Asn-GTT-3 3 to 8)
  97. Manacus vitellinus tRNA
  98. Marmota monax tRNA.Asn
  99. Megalops atlanticus tRNA-Asn
  100. Meleagris gallopavo tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 7)
  101. Melopsittacus undulatus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 5)
  102. Mercenaria mercenaria (Hard clam (quahog)) tRNA-Asn
  103. Merluccius polli tRNA-Asn
  104. Merops nubicus tRNA
  105. Mesitornis unicolor tRNA
  106. Mesocricetus auratus tRNA
  107. Microcebus murinus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 6)
  108. Monodelphis domestica tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  109. Mus caroli tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 7)
  110. Mus musculus castaneus tRNA-Asn (GTT) (tRNA-Asn-GTT-2 1 to 9)
  111. Mus musculus domesticus tRNA-Asn (GTT) (tRNA-Asn-GTT-2 1 to 9)
  112. Mus musculus musculus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 7)
  113. Mus musculus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9, tRNA-Asn-GTT-2 1 to 11, tRNA-Asn-GTT-3 1 to 9)
  114. Mus pahari tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 7)
  115. Mus spretus tRNA-Asn (GTT) (tRNA-Asn-GTT-3 1 to 6)
  116. Mustela putorius furo tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 4)
  117. Myotis brandtii tRNA
  118. Myotis davidii tRNA
  119. Neotoma lepida (desert woodrat) tRNA
  120. Nestor notabilis tRNA
  121. Nipponia nippon (crested ibis) tRNA
  122. Nomascus leucogenys tRNA-Asn (GTT) (tRNA-Asn-GTT-2 1 to 7)
  123. Notamacropus eugenii tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 11)
  124. Nothobranchius furzeri tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 4)
  125. Ochotona princeps tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  126. Octopus bimaculoides (California two-spot octopus) tRNA-Asn for anticodon GUU
  127. Octopus sinensis (East Asian common octopus) tRNA-Asn
  128. Ophiophagus hannah (king cobra) tRNA
  129. Opisthocomus hoazin tRNA
  130. Oreochromis niloticus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  131. Ornithorhynchus anatinus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 7)
  132. Oryctolagus cuniculus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
  133. Oryzias latipes tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 7)
  134. Ostrea edulis (European flat oyster) transfer RNA asparagine (anticodon GUU)
  135. Otolemur garnettii tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  136. Ovis aries tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 13)
  137. Pangasianodon gigas tRNA-Asn
  138. Pangasianodon hypophthalmus tRNA-Asn
  139. Pangasius djambal tRNA-Asn
  140. Pan troglodytes tRNA-Asn (GTT) (tRNA-Asn-GTT-4 1 to 5)
  141. Papio anubis tRNA-Asn (GTT) (tRNA-Asn-GTT-3 1 to 10)
  142. Patagioenas fasciata monilis tRNA
  143. Patella pellucida (Blue-rayed limpet) misc RNA ENSDPLG00005026489.1
  144. Patella vulgata (Common limpet) misc RNA ENSPVUG00005026789.1
  145. Patiria miniata (Bat star starfish) tRNA-Asn
  146. Pelecanus crispus tRNA
  147. Pelobates cultripes tRNA.Asn
  148. Pelodiscus sinensis tRNA
  149. Perca flavescens (yellow perch) tRNA-Asn
  150. Perca fluviatilis tRNA-Asn
  151. Petromyzon marinus tRNA-Asn (GTT) (tRNA-Asn-GTT-2 1 to 3)
  152. Phaethon lepturus tRNA
  153. Phalacrocorax carbo (great cormorant) tRNA
  154. Phrynosoma platyrhinos tRNA-OTHER
  155. Dryobates pubescens tRNA
  156. Podarcis lilfordi tRNA.Asn
  157. Podiceps cristatus tRNA
  158. Poecilia formosa tRNA
  159. Pomacea canaliculata (Apple snail) tRNA-Asn
  160. Pongo abelii tRNA-Asn (GTT) (tRNA-Asn-GTT-2-1, tRNA-Asn-GTT-2-2, tRNA-Asn-GTT-2 4 to 6, tRNA-Asn-GTT-2-8)
  161. Potamilus streckersoni tRNA-Asn
  162. Procavia capensis tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 7)
  163. Pseudomonadota bacterium tRNA-Asn
  164. Pterocles gutturalis (yellow-throated sandgrouse) tRNA
  165. Pteropus alecto (black flying fox) tRNA
  166. Pygoscelis adeliae tRNA
  167. Rattus norvegicus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 8)
  168. Saccoglossus kowalevskii (Acorn worm) tRNA-Asn
  169. Saimiri boliviensis boliviensis tRNA-Asn (GTT) (tRNA-Asn-GTT-2 1 to 6)
  170. SAR324 cluster bacterium tRNA-Asn
  171. Sarcophilus harrisii tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 13)
  172. Scleropages formosus (Asian bonytongue) tRNA
  173. Sorex araneus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  174. Sphaerodactylus townsendi tRNA-Asn
  175. Struthio camelus australis tRNA
  176. Sus scrofa tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
  177. Taeniopygia guttata tRNA-Asn (GTT) (tRNA-Asn-GTT-2 1 to 3)
  178. Takifugu rubripes tRNA-Asn (GTT) (tRNA-Asn-GTT-10 1 to 4)
  179. Tauraco erythrolophus (red-crested turaco) tRNA
  180. Tetraodon nigroviridis tRNA
  181. Tinamus guttatus tRNA
  182. Trichechus manatus latirostris tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 6)
  183. Trichinella britovi tRNA
  184. Trichinella murrelli tRNA
  185. Trichinella nativa tRNA
  186. Trichinella nelsoni tRNA
  187. Trichinella patagoniensis tRNA
  188. Trichinella spiralis tRNA
  189. Trichinella sp. T6 tRNA
  190. Trichinella sp. T8 tRNA
  191. Trichinella sp. T9 tRNA
  192. Trichuris muris tRNA
  193. Trichuris suis tRNA
  194. Trichuris trichiura tRNA
  195. Tupaia chinensis tRNA
  196. Tursiops truncatus tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 8)
  197. Tyto alba tRNA
  198. Vicugna pacos tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  199. Xenopus laevis tRNA
  200. Xenopus tropicalis tRNA-Asn (GTT) (tRNA-Asn-GTT-2 1 to 3)
  201. Xiphophorus maculatus (southern platyfish) tRNA
2D structure Publications