Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Alosa alosa (allis shad) tRNA-Arg secondary structure diagram

Alosa alosa (allis shad) tRNA-Arg URS000059900F_278164

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACCCAGUGGCCUAAUGGAUAAGGCAUCAGCCUCCGGAGCUGGGGAUUGUGGGUUCGAGUCCCAUCUGGGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 125 other species

  1. Ailuropoda melanoleuca tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1)
  2. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
  3. Albula goreensis tRNA-Arg
  4. Amazona aestiva tRNA
  5. Ameiurus melas tRNA-Arg
  6. Anas platyrhynchos tRNA
  7. Anguilla anguilla (European eel) tRNA-Arg
  8. Anolis carolinensis tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  9. Astyanax mexicanus tRNA
  10. Ataeniobius toweri tRNA-Arg
  11. Balaenoptera acutorostrata scammoni tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  12. Bos taurus tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  13. Callipepla squamata (scaled quail) tRNA
  14. Callithrix jacchus tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  15. Calypte anna (Anna's hummingbird) tRNA
  16. Camelus ferus tRNA
  17. Canis lupus familiaris tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  18. Carlito syrichta tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  19. Cavia porcellus tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1)
  20. Ceratotherium simum simum tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  21. Characodon lateralis tRNA-Arg
  22. Chelonia mydas (green seaturtle) tRNA
  23. Chlorocebus sabaeus tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1)
  24. Choloepus hoffmanni tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1)
  25. Chrysemys picta bellii tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  26. Colinus virginianus (northern bobwhite) tRNA
  27. Columba livia (rock pigeon) partial tRNA-Arg
  28. Crenichthys baileyi tRNA-Arg
  29. Cricetulus griseus tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1)
  30. Dallia pectoralis tRNA-OTHER
  31. Danionella translucida tRNA-Arg
  32. Danio rerio tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  33. Dasypus novemcinctus tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1)
  34. Dipodomys ordii tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1)
  35. Echinops telfairi tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  36. Egretta garzetta tRNA
  37. Eptesicus nilssonii tRNA-Arg
  38. Equus caballus tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  39. Erinaceus europaeus tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  40. Eurypyga helias (sunbittern) tRNA
  41. Felis catus tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  42. Ficedula albicollis tRNA
  43. Fukomys damarensis (Damara mole-rat) tRNA
  44. Gadus morhua tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  45. Gallus gallus tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  46. Gasterosteus aculeatus (three-spined stickleback) tRNA
  47. Gorilla gorilla gorilla tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1, tRNA-Arg-CCG-3-2)
  48. Heterocephalus glaber tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1)
  49. Hippoglossus stenolepis (Pacific halibut) tRNA-Arg
  50. Homo sapiens tRNA-Arg (anticodon CCG) 2-1 (TRR-CCG2-1)
  51. Ictidomys tridecemlineatus tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1)
  52. Lamprotornis superbus tRNA-OTHER
  53. Larimichthys crocea tRNA
  54. Latimeria chalumnae tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  55. Lepisosteus oculatus tRNA
  56. Leptosomus discolor tRNA
  57. Lonchura striata domestica (Bengalese finch) tRNA
  58. Loxodonta africana tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1)
  59. Macaca mulatta tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  60. Marmota monax (woodchuck) tRNA.Arg
  61. Megalops atlanticus tRNA-Arg
  62. Meleagris gallopavo tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  63. Melopsittacus undulatus tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  64. Merluccius polli tRNA-Arg
  65. Mesocricetus auratus (golden hamster) tRNA
  66. Microcebus murinus tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  67. Monodelphis domestica tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1, tRNA-Arg-CCG-2-2)
  68. Mus caroli tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  69. Mus musculus castaneus tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  70. Mus musculus domesticus tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1)
  71. Mus musculus musculus tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1)
  72. Mus musculus tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1)
  73. Mus pahari tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1)
  74. Mus spretus tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1)
  75. Mustela putorius furo tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  76. Myotis brandtii tRNA
  77. Myotis davidii tRNA
  78. Myotis lucifugus tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  79. Neotoma lepida tRNA
  80. Nomascus leucogenys tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  81. Notamacropus eugenii tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  82. Nothobranchius furzeri tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  83. Ochotona princeps tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1)
  84. Ophiophagus hannah tRNA
  85. Oreochromis niloticus tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  86. Ornithorhynchus anatinus tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1, tRNA-Arg-CCG-3-2)
  87. Oryctolagus cuniculus tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1)
  88. Oryzias latipes tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  89. Otolemur garnettii tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1)
  90. Ovis aries tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  91. Pangasianodon gigas (Mekong giant catfish) tRNA-Arg
  92. Pangasianodon hypophthalmus tRNA-Arg
  93. Pangasius djambal tRNA-Arg
  94. Pan troglodytes tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  95. Papio anubis tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  96. Patagioenas fasciata monilis tRNA
  97. Pelecanus crispus tRNA
  98. Pelobates cultripes (western spadefoot toad) tRNA.Arg
  99. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  100. Perca flavescens tRNA-Arg
  101. Perca fluviatilis (European perch) tRNA-Arg
  102. Phrynosoma platyrhinos tRNA-OTHER
  103. Dryobates pubescens tRNA
  104. Pleuronectes platessa tRNA-Arg
  105. Podarcis lilfordi tRNA.Arg
  106. Poecilia formosa tRNA
  107. Pongo abelii tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  108. Procavia capensis tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  109. Pteropus alecto tRNA
  110. Rattus norvegicus tRNA-Arg (CCG) (tRNA-Arg-CCG-3-1)
  111. Saimiri boliviensis boliviensis tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  112. Salmo salar (Atlantic salmon) tRNA
  113. Sarcophilus harrisii tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  114. Scleropages formosus (Asian bonytongue) tRNA
  115. Sorex araneus tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  116. Sphaerodactylus townsendi tRNA-Arg
  117. Sus scrofa tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  118. Takifugu rubripes tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  119. Tetraodon nigroviridis tRNA
  120. Trichechus manatus latirostris tRNA-Arg (CCG) (tRNA-Arg-CCG-4-1)
  121. Tupaia chinensis (Chinese tree shrew) tRNA
  122. Tursiops truncatus tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  123. Vicugna pacos tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1)
  124. Xenopus laevis tRNA
  125. Xiphophorus maculatus tRNA
2D structure