Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Aedes aegypti (yellow fever mosquito) aae-miR-12-5p URS0000588E2B_7159

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

aae-mir-12: Aae-mir-12 is a mosquito microRNA that is upregulated by Wolbachia infection and has been found to play a crucial role in the growth and persistence of Wolbachia in host cells. It has been shown to suppress the expression of two genes, monocarboxylate transporter (MCT1) and DNA replication licensing factor (MCM6), which are important for Wolbachia's persistence in the host cell [PMC8261290]. Inhibition of aae-mir-12 using specific inhibitors has been shown to reduce Wolbachia density and replication [PMC3997519]. Aae-mir-12 has also been found to be highly upregulated in CHIKV-infected Aedes aegypti saliva, suggesting its involvement in viral infection [PMC4303268]. In Aag2 cells, inhibition of aae-mir-12 resulted in reduced CHIKV replication [PMC4303268]. The target genes of aae-mir-12, MCM6 and MCT1, have been functionally validated both in vitro and in vivo [PMC3500346]. Transfection with synthetic aae-mir-12 inhibitors reduced Wolbachia density, further supporting the role of aae-mir-12 in Wolbachia's persistence [PMC3500346]. The interaction between aae-mir-12 and its target genes has been confirmed through various experiments using synthetic mimics and inhibitors [PMC3500346]. Overall, these findings highlight the importance of aae-mir-12 in mediating the interaction between Wolbachia and its host cells.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGUAUUACAUCAGGUACUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Anopheles gambiae (African malaria mosquito) aga-miR-12
  2. Apis mellifera ame-miR-12-5p
  3. Blattella germanica Bge-Mir-12_5p (mature (guide))
  4. Culex quinquefasciatus cqu-miR-12-3p
  5. Daphnia magna Dma-Mir-12_5p (mature (guide))
  6. Daphnia pulex (common water flea) dpu-miR-12
  7. Drosophila ananassae dan-miR-12
  8. Drosophila erecta der-miR-12
  9. Drosophila grimshawi dgr-miR-12
  10. Drosophila melanogaster dme-miR-12-5p
  11. Drosophila mojavensis dmo-miR-12
  12. Drosophila persimilis dpe-miR-12
  13. Drosophila pseudoobscura dps-miR-12
  14. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294493_df_nrg
  15. Drosophila sechellia dse-miR-12
  16. Drosophila simulans dsi-miR-12
  17. Drosophila virilis dvi-miR-12-5p
  18. Drosophila willistoni dwi-miR-12
  19. Hyalella azteca miR-12-1
  20. Ixodes ricinus (castor bean tick) iri-miR-12-5p
  21. Ixodes scapularis isc-miR-12
  22. Limulus polyphemus Lpo-Mir-12-P6_5p (mature (guide))
  23. Nasonia longicornis nlo-miR-12
  24. Nasonia vitripennis nvi-miR-12
  25. Penaeus japonicus miR-12
  26. Polistes canadensis pca-miR-12-5p
  27. Tribolium castaneum Tca-Mir-12_5p (mature (guide))
  28. Triops cancriformis tcf-miR-12
Publications