v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ACAP2 intronic transcript 1 (ACAP2-IT1) URS000057D897_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ACAP2-IT1: ACAP2-IT1 is an m6A-modified long non-coding RNA (lncRNA) that has been identified as one of the four lncRNAs (AC010894.3, ACAP2-IT1, CACNA1G-AS1, and UBA6-AS1) involved in m6A regulation and with significant prognostic value in ovarian cancer (OC) [PMC10111779]. ACAP2-IT1 has been found to be a risk factor for OC patients' overall survival (OS) [PMC8268297]. It is also associated with the regulation of N6-methyladenosine, which plays a role in carcinogenesis and cancer inhibition [PMC9906052]. ACAP2-IT1 has been predicted to regulate the expression of RBM15, an m6A writer protein [PMC8268297]. Furthermore, specific lncRNAs such as CACNA1G-AS1 and ACAP2-IT1 have been predicted to regulate the expression of m6A readers and writers [PMC8968631]. The prognostic value of ACAP2-IT1 has been demonstrated in OC detection and survival rate prediction models based on m6A-related lncRNAs [PMC9178823] [PMC10111779] [PMC8268297]. ACAP2-IT1 has been found to have a positive correlation with RBM15, which is consistent with previous research [PMC9108167]. Overall, ACAP2-IT1 is an m6A-modified lncRNA that has been implicated in OC prognosis and m6A regulation.

Targeting miRNAs 9 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAUAUGCUUAGUAUUAUAAAUGUUGAGUGAUGAGUUGUUUACCAUUUAUAAUAAACUGUUAAAUGUAUUUCUGGGAACAUUCCAUGGCAGCAUAUUCUGGGUUGUUGUUUAUGUGUUCCAAUGUAGACAAAUUAUAUUUGCCUUGGGAAAAAUUCUAAGUAAUCAAAAUUAUAUUUAAAUAUUAAAAAAUCACAUUGAAGUUCAAUUUGUGUUAGCUGUAUUAAAUAUCUUGGUCACUAUUGUUCUUGUAACAUUUGCUUUUGACAACACAUUUUGAGAUCUAAGAAAGGUAGUACAUUAACAGUGCAUUAAUUAAUGUUUUGUUAGAAACUAAAUGUUAACAAAAAGUUUUGUGUGUAUGUGAAGGUGGCAACUUCCUUUUGUAUUAUAUUAACACUUUUUAAAUGUAUUCAGUCAGUGAAACCAAUGAUUAUUAUAGCACCAACACUUUCAUUCAAGGAAGCAUUUGAGUCUUAUAAUUUGUUUUGCAUGGUACAAUGGUUCUACUAAAAUAUACUUGUGUAAUAGGUACUAGAUGAUUUAAAAACAAAACCGGAGAAACCAUUUAAAAAGUUCCAUAGCUUGUUAUACAAAAUAUGCAUUGCUAAUGUUUAGCAGGAAGCAUUCAUGAUCAACGAUUUAUCUUGAAAAUAAGAUUCCUUCGUCUGAGGGAUUGAUCUGUAUGUGUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications