Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-126809
URS000056803A_8364
Genome locations
Gene Ontology annotations
Loading ontology ancestors...
Failed to load QuickGO Ancestor chart
![]()
Sequence
Sequence features are shown above as colored rectangles.
Zoom in and click to view details, or
Reset
GACGAGGUGGCCGAGUGGUUAAGGCAAUGG
Taxonomic tree
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree.
Click tree nodes to collapse or expand them.
Hover over taxon names to display additional information.
This sequence is found in 7 other species
Download
