Mandrillus leucophaeus (Drill) microRNA 484 (ENSMLEG00000011782.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mandrillus leucophaeus (Drill) microRNA 484 (ENSMLEG00000011782.1) URS00005651EE_9568

79 nucleotides
1 database (Ensembl)
Found in 13 other species
41 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AGCCUCGUCAGGCUCAGUCCCCUCCCGAUAAACCCCUAAAUAGGGACUUUCCCGGGGGGUGACCCUGGCUUUUUUGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

Cebus imitator microRNA 484 (ENSCCAG00000020426.1)
Cercocebus atys microRNA 484 (ENSCATG00000043292.1)
Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000009935.1)
Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 484 (ENSGGOG00000033075.2)
Homo sapiens (human) microRNA hsa-mir-484 precursor
Macaca nemestrina microRNA 484 (ENSMNEG00000025047.1)
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 484 (ENSNLEG00000025009.2)
Pan paniscus microRNA 484 (ENSPPAG00000009464.1)
Pan troglodytes (chimpanzee) ptr-mir-484 (ENSPTRG00000027839.3)
Pongo abelii miRNA
Pongo pygmaeus microRNA ppy-mir-484 precursor

2D structure

Publications