Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-593 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-593 precursor URS000052FD62_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-593: Hsa-mir-593 is a microRNA gene that is located within an intron of the SND1 gene, which is a component of the RNA-induced silencing complex (RISC) [PMC3675212]. This microRNA has been observed to increase in abundance in induced pluripotent stem cells (iPSCs) and human embryonic stem cells (hESCs) compared to normal human dermal fibroblasts (NHDFs), suggesting a role in stem cell biology [PMC4609408]. Additionally, hsa-mir-593 has been identified as one of the microRNAs with elevated levels in exosomes induced by rWNT5A, although caution is advised due to low amounts of microRNA [PMC4022450]. It has also been noted as a candidate hub miRNA within networks up-regulated in poor prognosis, potentially implicating it in cell cycle regulation [PMC8004706]. A specific variant within hsa-mir-593, rs73721294, alters its sequence and could potentially affect its function; however, further validation of this variant's impact is required [PMC3675212], [PMC6863982]. Despite its emerging significance, hsa-mir-593 was excluded from a study predicting miRNAs that target wild-type 3'UTR due to specific criteria set by the researchers [PMC2945965].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCCCAGAAUCUGUCAGGCACCAGCCAGGCAUUGCUCAGCCCGUUUCCCUCUGGGGGAGCAAGGAGUGGUGCUGGGUUUGUCUCUGCUGGGGUUUCUCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression Publications