Trichechus manatus latirostris tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Trichechus manatus latirostris tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1) URS0000520742_127582

82 nucleotides
1 database (GtRNAdb)
Found in 1 other species
1 publications
1. sncRNA
2. tRNA
3. seryl tRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GUAGUCGUGGCCGAGUGGUUAAGGCGAUGGACUAGAAAUCCAUUGGGGUUUCCCCACGCAGGUUCGAAUCCUGCCGACUACG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Homo sapiens tRNA-Ser (anticodon AGA) 3-1 (TRS-AGA3-1)

2D structure

Publications