Gorilla gorilla gorilla (Western Lowland Gorilla) Small nucleolar RNA SNORD73 (ENSGGOG00000029784.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla (Western Lowland Gorilla) Small nucleolar RNA SNORD73 (ENSGGOG00000029784.2) URS000051B5A1_9595

65 nucleotides
2 databases (Ensembl, Rfam)
Found in 3 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AAUAAGUGAUGAAAAAAGUUUCGGUCCCAGAUGAUGGCCAGUGAUAACAACAUUUUUCUGAUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Homo sapiens small nucleolar RNA, C/D box 73A (SNORD73A)
Pan paniscus Small nucleolar RNA SNORD73 (ENSPPAG00000020400.1)
Pan troglodytes Small nucleolar RNA SNORD73 (ENSPTRG00000032893.2)

2D structure