Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR160e-5p URS000051441D_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR160e-5p: Osa-mir160e-5p is a microRNA that is part of a larger group of miRNAs involved in gene regulation in rice. It is classified as a conserved miRNA and has been found to display an inverse expression pattern in CS and FLS datasets [PMC9597502]. During coleoptile senescence, osa-mir160e-5p, along with other conserved miRNAs, was highly upregulated [PMC9597502]. Osa-mir160e-5p has been shown to target ARF6 and ARF8 genes, which are involved in the production of jasmonic acid (JA) [PMC4257594]. In rice leaves at different stages of grain-filling, the expression of osa-mir160e-5p was significantly higher in N2Y6 compared to LYP9, leading to decreased expression of ARF6 and ARF8 and repression of JA production [PMC4257594]. Conversely, in the same leaves at different stages of grain-filling, osa-mir160e-5p was significantly lower in N2Y6 compared to LYP9, resulting in increased expression of ARF8 and other genes involved in leaf senescence [PMC4257594]. Osa-mir160e-5p has also been found to target several members of the ARF gene family [PMC4257594]. Additionally, osa-mir160e-5p showed higher expression levels in control as well as stress conditions (SDS and REC) in N22 roots [PMC5447883].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCUGGCUCCCUGUAUGCCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Citrus sinensis csi-miR160b-5p
  2. Manihot esculenta (cassava) mes-miR160c
  3. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR160e-5p
  4. Zea mays (maize) zma-miR160f-5p
Publications