Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Caenorhabditis elegans microRNA cel-mir-239b precursor URS0000506BCE_6239

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cel-mir-239b: Cel-mir-239b is a microRNA (miRNA) that is used as a negative control in various experiments. It has minimal sequence identity with miRNAs in human, mouse, and rat [PMC2699527]. In different studies, cel-mir-239b has been used as a control miRNA in experiments involving the inhibition of miRNAs function [PMC7253519]. It has been co-transfected with different vectors and synthetic miRNAs to assess the effects on gene expression [PMC7253519]. Cel-mir-239b has also been used as a negative control in studies involving the transfection of microRNA mimics and inhibitors [PMC7708977] [PMC9617134] [PMC4260481] [PMC4546478] [PMC3743786]. Additionally, cel-mir-239b has been employed as a negative control in experiments using siRNAs to minimize off-target effects and equalize the total amount of small RNA [PMC8019740] [PMC3572043]. It has also been used as a negative control in studies investigating microRNA expression and gene regulation using mimics or inhibitors of specific miRNAs [PMC6502783] [PMC4308918] [PMC5460990]  [ [ [ [ [ [ . In summary, cel-mir-239b is commonly used as a negative control in various experimental settings to assess the specific effects of other miRNAs or RNAi molecules.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGACAGAUGCAAUUUUUGUACUACACAAAAGUACUGGUCAUUUAAGUUGAGGCUCAGCACUUUUGUGGUGUGCAAAAAUGGCAAGUUGCUUUUAUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications