Homo sapiens (human) TRPC7 antisense RNA 1 (TRPC7-AS1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) TRPC7 antisense RNA 1 (TRPC7-AS1) URS000050693C_9606

460 nucleotides
10 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, LncBook, LNCipedia, MalaCards, NONCODE, RefSeq)
Found in 0 other species
17 publications
1. lncRNA
2. antisense lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

TRPC7-AS1: TRPC7-AS1 is a long non-coding RNA (lncRNA) that is highly expressed in hepatocellular carcinoma (HCC) patients and hepatoma cell lines [PMC8648018]. However, the specific biomolecular mechanism of TRPC7-AS1 in pancreatic ductal adenocarcinoma (PDAC) is still unclear and requires further validation [PMC9549010]. Recent research by Zhu et al. suggests that TRPC7-AS1 lncRNA expression may be regulated by N6-methyladenosine (m6A) modification [PMC8648018]. They found that TRPC7-AS1 lncRNA had low levels of m6A modification in HCC patients and hepatoma cell lines, indicating a potential role for m6A in the regulation of TRPC7-AS1 expression [PMC8648018]. In summary, TRPC7-AS1 is a highly expressed lncRNA in HCC patients and hepatoma cell lines. However, its specific role and mechanism in PDAC are still unclear and require further investigation. Zhu et al. suggest that m6A modification may play a role in the regulation of TRPC7-AS1 expression [PMC9549010] [PMC8648018].

Targeting miRNAs 1 total

According to LncBase, this RNA is targeted by the following miRNAs:

hsa-miR-33a-3p

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CAGGAGCCUGGAGAGAAUGGCUCGGCACAGCAGAUGCAGCCGUGGUGGCCAUGGAGCUGACCAGCCUCUUGGGAGUGAGCUGGCCACCUGAGCACGGUCCACUCAGCCCACACAAGCAGCAGCACCACCUCGCUGACAGGAGCUUCGUCAAUGCCUGCCGCCUCCUCCUUCCAUAACGAGGGACCACCUAGCAGGGACUUUCACUUUUAUUUCCACAGAGAACCUUGUGGUUAGAAGUCCAAUGGGUCUAGGCUGUGGGAAUCUUCUUAUUAACCACAAACAGAUGUCAAAAGGAUCUUUCCUAAUACUGUAGAUACUGCACUUGGCUCGUGUGGGAGUCCACUGUCUGUGGAAACAUUACUCGUCUAUUUUUCAGGUCUGCAGAGCCCAGACUGAAAAACACAUUAAAAAAAUGGUUUUGUGAAAAAUAACAAUUCAGACACCCUGGAGCCUAAGGAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications