Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cervus elaphus (red deer) cel-miR-99a URS0000502116_9860

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACCCGUAGAUCCGAUCUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus (cattle) bta-miR-99a-5p
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-99
  3. Canis lupus familiaris (dog) cfa-miR-99a
  4. Capra hircus (goat) chi-miR-99a-5p
  5. Cricetulus griseus cgr-miR-99a-5p
  6. Cyprinus carpio (common carp) ccr-miR-99
  7. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-99b
  8. Mus musculus Mus_musculus piRNA piR-mmu-72681
  9. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-99a
  10. Ornithorhynchus anatinus (platypus) oan-miR-99-5p
  11. Ovis aries microRNA miR-99a
  12. Pteropus alecto pal-miR-99a-5p
  13. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63017
  14. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-99a
  15. Taeniopygia guttata (zebra finch) tgu-miR-99-5p
  16. Tursiops truncatus miR-99a
  17. Xenopus laevis xla-miR-99-5p
  18. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3014282