v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2043 (LINC02043) URS00004FA0FF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02043: LINC02043 is a long non-coding RNA (lncRNA) that has been found to be highly expressed in colorectal cancer (CRC) cell lines compared to normal colon epithelial cell lines [PMC6953771]. It was one of the five most upregulated lncRNAs among the candidates tested in CRC cell lines [PMC6953771]. In addition to CRC, LINC02043 has also been implicated in hepatocellular carcinoma as a prognostic marker of recurrence-free survival [PMC7758476]. It is associated with disease risk and recurrence-free survival in various cancers, including CRC [PMC9529468] and hepatocellular carcinoma [PMC7758476]. LINC02043 is expressed primarily in brain, adipose, testis, arterial, and splenic tissues [PMC7511027]. Variants associated with lower plasma adiponectin levels are also associated with lower expression levels of LINC02043 [PMC7511027]. In terms of its role as a biomarker, LINC02043 has been identified as one of the lncRNAs significantly correlated with recurrence-free survival in CRC patients [PMC7339747]. Increased expression of LINC02043 predicts worse recurrence-free survival in CRC patients according to a risk scoring system developed using multiple lncRNAs as predictors [PMC7339747]. References: - PMC6953771 - PMC7758476 - PMC9529468 - PMC7511027 - PMC7339747

Targeting miRNAs 1 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUCUGGGUGAGCAGGCAGCGGACAAGUGACGUCUCCCGGCCUGCUGCCCCAGGCCCCCCACAAGCCGCGUUCUGGGGCCGUGGCCUCCCCAGAGCAGAUCAGUGGGGGCUGUGUGAGCAACACUGGGGGCAGCUGGGCAGCGCCUCCCUGGAGGCCCCUCUGAAAUCCCGCCGGAUGCUGGCAGGCUCCAAGGGGGCUGGACACCAUCUUCUCAGGGCCCUGCAGGGAAGCGUGGAAAGGCGGCACAGGGCUGGACCCAGAGGAGCUCUCAGAUGCUGGACUGGACUGUUUCAGGGGUCAUCUAGCCCAUUCCCCGCCUCCAGGCGAGGAUUUGCUUGAGCCUGGAAAGAUGAAGGAUCCUCCCAGUGCCGUCAAGCCCCGGAUUCCACCUCCCUGUAGGUGGACUGCCAGCGCAGGCCCUGACAACGCAGAGAAAGACACAGGACCCAGCUGGGCCAGUGACAGCAGGAGCUCCUGGUGCCACAGGAAUGGAAACUGUGACUCAUAAUAGCCAGCUAGUCAAUGAUUAUUCCCCCCAGUCCCUGGCGCAUCAAGAUUUGCUGUGCUCAAUGGUGCCCAGACUGGAGUACAGUGGCGUGAUCUCGGCUCGCUACAACCUCCACCUCCCAGCCACCUGCCUUGGCCUCCCAAAGUGCCGAGAUUGCAGCUUCUGCCUGGCUGCCACCCCGUCUGGGAAGUGAGGAGCGUCUCUGCCUGGCCGCCCAUCGUCUGGGAUGUGAGGAGCCCCUCUGCCUGGCUGCCCAGUCUGGGAAGUGAGGAGCGUCUCUGCCCAGCCGCCAUCCCAUCUAGGAAGGGAGGAGCGUCUCUGCCCAGCUGCCCAUCGUCUGAGAUGUGGGGAGCGCCUCUGCCCCGCCGCCCCGUCUGGGAUGUGAGGAGCGCCUCUGCCCGGCCGCGACCCUGUCUGGGAGGUGAGGAGCGUCUCCACCUGGCAGCCACCCCGUCCGGGAGGGAGGUGGGGGUCAGCCCCCACCAGGCCAGCCGCCCCGUCCGGGAGGGAGGUGGGGGGGUCAGCCCCCCGCCCGGCCAGCCGCCCCGUCUGGGAGGGAGGUGGGGGGGUCAGCCCCCCACCCGGCCAGCCGCCCCGUCCGGGAGGUGAGGGGCGCCUCUGCCCGGCCGCCCCUACUGGGAAGUGAGGAGCCCCUCUGCCCGGCCAGCCGCCCUGUCCGGGAGGGAGGUUGGGGUGGGGGGGUCAGCCCUCCGCCCGGCCUGCCGCCCCGUCCGGGAGGUGAGGGGCGCCUCUGCCCGGCCACCCCUACUGGGAAGUGAGGAGCCCCUCUGCCCGGCCACCACCCCGUCUGGGAGGUGUGCCCAGCGGCUCAUUGAGAACGGGCCAUGAUGACAGUGGCGGUUUUGUGGAAUAGAAAGGGGGAAAAGGUGGGGAAAAGAUUGAGAAAUCAGAUGGUUGCCGUGUCUGUCUAGAAAGAAGUAGACAUGGGAGACUUUUCAUUUUGUUCUGUACUAAGAAAAAUUCUUCUGCCUUGGGAUCCUGUUGAUCUGUGACCUUACCCCCAACCCUGUGCUCUCUGAAACAUGUGCUGUAUCCACUCAGGGUUGAAUGGAUUAAGGGCGGUGCAAGAUGUGCUUUGUUAGACAGAUGCUUGAAGGCAGCAUGCUCGUUAAGAGUCAUCACCACUCCCUAAUCUCAAGUACCCAGGGACACAAACACUGCGGAAGGCCGCAGGGUCCUCUGCCUAGGAAAACCAGAGACCUUUGUUCACUUGUUUAUCUGCUGACCUUCCCUCCACUAUUGUCCUAUGACCCUGCCAAAUCCCCCUCUGCGAGAAACACCCAAGAAUGAUCAAUAAAAAAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications