Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-592 URS00004F507C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-592: hsa-mir-592 is a microRNA that has been implicated in various cancer-related processes and pathways. It has been found to correlate with monosomy 3 tumors, suggesting a potential role in tumor development or progression [PMC7958896]. In breast cancer, hsa-mir-592 expression was markedly elevated, with levels approximately twenty-three times higher than in healthy samples, and it was identified as a regulator of the extrinsic prothrombin activation pathway [PMC6208346]. This microRNA is also part of a group that regulates both extrinsic and intrinsic prothrombin pathways [PMC4512830]. Significant expression differences of hsa-mir-592 have been observed when comparing uterine artery samples to controls [PMC5650163]. In the context of metastatic tumors, hsa-mir-592 was among the miRNAs found to be upregulated [PMC7140886], and it was also more highly deregulated in high-grade disease patients compared to those with low-grade disease [PMC6423615]. Additionally, hsa-mir-592 has been implicated in potentially regulating mRNAs related to preeclampsia and may indirectly affect tick-borne encephalitis virus replication as well [PMC8176413; PMC9167876]. It is also recognized for its contribution to prediction accuracy in miRNA-related studies and can effectively distinguish between high-risk and low-risk groups according to Kaplan–Meier analysis [PMC6208346; PMC9695425].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGUGUCAAUAUGCGAUGAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

Relationships

Molecular Relationships

Publications