Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR1425-5p URS00004F38F3_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR1425-5p: Osa-mir1425-5p is a microRNA that has been studied in the context of fungal infection in rice. It has been found to be downregulated during infection by various strains of fungus, including R. solani, and its expression is reduced during all time points of infection [PMC7662745]. Osa-mir1425-5p, along with other miRNAs such as Osa-miR398b and Osa-miR159b, has been identified as a basal response regulator against the R. solani pathogen in both susceptible and resistant rice cultivars [PMC7662745]. It is more abundantly present in R. solani-infected sequencing libraries [PMC7662745]. Additionally, osa-mir1425-5p has been found to be highly downregulated in PBSR (partial blast susceptible reaction) rice cultivars compared to PKSR (partial kernel smut resistant) cultivars [PMC7226372]. It has also been identified as one of the most abundantly expressed conserved miRNAs in DXWR (Dongxiang wild rice) [PMC9960954]. Furthermore, osa-mir1425-5p has a potential role in modulating root architecture and energy metabolism in roots of rice plants [PMC6043990]. Overall, osa-mir1425-5p appears to play a significant role in the immune response of rice against fungal pathogens and may have implications for root development and energy metabolism.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGGAUUCAAUCCUUGCUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Oryza sativa Japonica Group microRNA osa-miR1425-5p
Publications