Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-29a precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-29a precursor URS00004E9304_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir29a: MIR29A is a microRNA involved in various biological processes, including matrix remodeling and fibrosis, as indicated by its formation being primed by myocardin [PMC7123062]. In the context of lung cancer, MIR29A levels were found to be significantly lower in patients with non-small cell lung cancer (NSCLC) compared to small cell lung cancer (SCLC) [PMC9987486]. Additionally, MIR29A is differentially expressed in Parkinson's disease (PD) compared with vascular parkinsonism (VP), suggesting its potential role in disease-specific pathologies [PMC8407885]. However, its elevated expression has been associated with poor patient survival across various conditions, suggesting a prognostic role for MIR29A [PMC6368411]. In the liver, TGF-β1 may induce Fstl1 partially through the downregulation of MIR29A, and there appears to be a reciprocal regulatory relationship between Fstl1 and MIR29A in hepatic stellate cells (HSCs) [PMC7493388]. Furthermore, upregulation of MIR29A has been observed in breast cancer stem cells (BCSCs), aggressive breast cancer cell lines, and breast cancer tissues [PMC9102147], highlighting its potential involvement in tumor aggressiveness. Lastly, research on liver fibrosis has underscored the importance of MIR29A during the regression of this condition [PMC6412626].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGACUGAUUUCUUUUGGUGUUCAGAGUCAAUAUAAUUUUCUAGCACCAUCUGAAAUCGGUUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 30 other species

  1. Ailuropoda melanoleuca mir-29
  2. Aotus nancymaae (Ma's night monkey) microRNA 29a (ENSANAG00000013314.1)
  3. Ateles geoffroyi microRNA age-mir-29a precursor
  4. Bos taurus microRNA bta-mir-29a precursor
  5. Callithrix jacchus (white-tufted-ear marmoset) mir-29 microRNA precursor
  6. Canis lupus familiaris (dog) mir-29 microRNA precursor
  7. Capra hircus (Goat) microRNA mir-29a (ENSCHIG00000009009.1)
  8. Carlito syrichta (Philippine tarsier) microRNA 29a (ENSTSYG00000023617.2)
  9. Cavia porcellus mir-29 microRNA precursor
  10. Cebus imitator (Panamanian white-faced capuchin) microRNA 29a (ENSCCAG00000016206.1)
  11. Cercocebus atys (Sooty mangabey) microRNA 29a (ENSCATG00000015753.1)
  12. Chlorocebus sabaeus mir-29 microRNA precursor
  13. Colobus angolensis palliatus miRNA (ENSCANG00000037675.1)
  14. Equus caballus mir-29 microRNA precursor
  15. Felis catus (domestic cat) mir-29 microRNA precursor
  16. Fukomys damarensis mir-29 microRNA precursor
  17. Gorilla gorilla gorilla ggo-mir-29a (ENSGGOG00000032853.2)
  18. Gorilla gorilla (western gorilla) microRNA ggo-mir-29a precursor
  19. Heterocephalus glaber (naked mole-rat) mir-29 microRNA precursor
  20. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-29a precursor
  21. Loxodonta africana mir-29 microRNA precursor
  22. Macaca mulatta (Rhesus monkey) microRNA mml-mir-29a precursor
  23. Macaca nemestrina microRNA mne-mir-29a precursor
  24. Mandrillus leucophaeus (Drill) microRNA 29a (ENSMLEG00000013113.1)
  25. Marmota monax (woodchuck) non-coding RNA
  26. Microcebus murinus mmr-mir-29a (ENSMICG00000018399.3)
  27. Nomascus leucogenys nle-mir-29a (ENSNLEG00000024513.2)
  28. Otolemur garnettii (small-eared galago) mir-29 microRNA precursor
  29. Ovis aries microRNA oar-mir-29a precursor
  30. Pan paniscus microRNA ppa-mir-29a precursor
  31. Panthera pardus microRNA 29a (ENSPPRG00000014670.1)
  32. Panthera tigris altaica (Tiger) microRNA 29a (ENSPTIG00000001473.1)
  33. Pan troglodytes microRNA ptr-mir-29a precursor
  34. Papio anubis (Olive baboon) mir-29 microRNA precursor
  35. Pongo abelii miRNA
  36. Pongo pygmaeus microRNA ppy-mir-29a precursor
  37. Propithecus coquereli (Coquerel's sifaka) microRNA 29a (ENSPCOG00000008303.1)
  38. Rhinopithecus bieti (Black snub-nosed monkey) microRNA 29a (ENSRBIG00000008246.1)
  39. Rhinopithecus roxellana microRNA 29a (ENSRROG00000002738.1)
  40. Saguinus labiatus microRNA sla-mir-29a precursor
  41. Saimiri boliviensis boliviensis microRNA 29a (ENSSBOG00000036361.1)
  42. Ictidomys tridecemlineatus mir-29 microRNA precursor
  43. Sus scrofa (pig) mir-29 microRNA precursor
  44. Tupaia belangeri chinensis (Chinese tree shrew) mir-29 microRNA precursor
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression GoFlow Results Publications