Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small NF90 (ILF3) associated RNA A10 (SNAR-A 3 to 11, SNAR-A14) secondary structure diagram

Homo sapiens (human) small NF90 (ILF3) associated RNA A10 (SNAR-A 3 to 11, SNAR-A14) URS00004E56CF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNAR-A6: SNAR-A6 is a non-coding RNA that has been identified in various contexts [PMC8127991]. It has been found to be identical to other cloned snaR-A sequences, including SNAR-A6, 7, 8, 9, 10, and 11 [PMC8127991]. SNAR-A6 has been shown to be incorporated in SIV virions and is more abundant in SIV samples compared to mock samples [PMC3781035]. It has also been identified as a previously unknown fragment derived from SNAR-A6 [PMC3781035]. SNAR-A6 is described as a highly connected gene in Subg 1 of certain subtypes [PMC7563496]. In addition, SNAR-A6 has been found to have gained DNMT3B binding upon PTS and is one of the genes that fell into the category of oncogenes [PMC8388921]. It is also one of the transcripts that were not recognized by Ensembl [PMC9405746]. The expression of SNAR-A6 can be compared with the Pol III-dependent expression of other elements [PMC4333407]. Assays have been performed for SNAR-A6 using specific sequences for detection [PMC7863452]. References: - [PMC8127991] - [PMC3781035] - [PMC7563496] - [PMC8388921] - [PMC9405746] - [PMC4333407] - [PMC7863452]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCGGAGCCAUUGUGGCUCAGGCCGGUUGCGCCUGCCCUCGGGCCCUCACGGAGGCGGGGGUUCCAGGGCACGAGUUCGAGGCCAGCCUGGUCCACAUGGGUCGGAAAAAAGGAUUUUUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications