Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 18A (SNORD18A) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 18A (SNORD18A) URS00004DF250_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD18A: SNORD18A is a small nucleolar RNA (snoRNA) that has been studied in various contexts [1]. In a study, it was found that SNORD18A has a single clear target binding region, overlapping and downstream of the box D' [PMC9226514]. This suggests that SNORD18A may play a causal role in the TGCT GWAS loci [PMC7313177]. Additionally, the expression of SNORD18A was found to be significantly correlated with the SNP rs12905354, which is in linkage disequilibrium with rs60180747 [PMC7313177]. In NSCLC samples, SNORD18A was downregulated in the supernatant of the 160,000× g fraction [PMC7461500]. Furthermore, SNORD18A was identified as one of 10 downregulated snoRNAs (SNORD6, SNOTRD116-23, SNORD116-25, SNORD116-29, SNORD42A, SNORD43, SNORD58C, SNORD60, and SNORD101) and two downregulated small nucleolar RNAs (SNORA3B and SNORA20) [PMC8742282]. These findings highlight the potential role of snoRNA 18A in various biological processes and diseases [PMC8742282].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUAGUGAUGAAAUUCCACUUCAUUGGUCCGUGUUUCUGAACCACAUGAUUUUCUCGGAUGUUCUGAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications