Xenopus tropicalis (tropical clawed frog) xtr-miR-93a URS00004DAA7C_8364

• 22 nucleotides
• 3 databases (miRBase, PirBase, RefSeq)
• Found in 15 other species
• 8 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. piRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

AAAGUGCUGUUCGUGCAGGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

1. Ateles geoffroyi age-miR-93
2. Capra hircus miR-93
3. Gorilla gorilla gorilla ggo-miR-93 (MIR93)
4. Gorilla gorilla ggo-miR-93
5. Homo sapiens (human) microRNA miR-93
6. Lagothrix lagotricha (brown woolly monkey) lla-miR-93
7. Macaca mulatta mml-miR-93-5p
8. Macaca nemestrina mne-miR-93
9. Monodelphis domestica (gray short-tailed opossum) mdo-miR-93-5p
10. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-5860375
11. Ovis aries (sheep) miscellaneous RNA
12. Pan paniscus ppa-miR-93
13. Pan troglodytes (chimpanzee) ptr-miR-93
14. Pongo pygmaeus (Bornean orangutan) ppy-miR-93
15. Saguinus labiatus sla-miR-93

Publications Download

• FASTA
• JSON