Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Choloepus hoffmanni tRNA-Lys (CTT) (tRNA-Lys-CTT-3 1 to 6) secondary structure diagram

Choloepus hoffmanni tRNA-Lys (CTT) (tRNA-Lys-CTT-3 1 to 6) URS00004D9E92_9358

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCCGGCUAGCUCAGUCGGUAGAGCAUGGGACUCUUAAUCCCAGGGUCGUGGGUUCGAGCCCCACGUUGGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 112 other species

  1. Ailuropoda melanoleuca tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1, tRNA-Lys-CTT-2-2)
  2. Alligator mississippiensis tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1, tRNA-Lys-CTT-2-2)
  3. Amazona aestiva tRNA
  4. Amphibalanus amphitrite (Acorn barnacle) tRNA-Lys
  5. Anolis carolinensis tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1)
  6. Anopheles stephensi tRNA tRNA-Lys
  7. Apaloderma vittatum tRNA
  8. Arabis alpina (gray rockcress) tRNA
  9. Balaenoptera acutorostrata scammoni tRNA-Lys (CTT) (tRNA-Lys-CTT-3-1, tRNA-Lys-CTT-3-2)
  10. Balearica regulorum gibbericeps tRNA
  11. Bos taurus tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1, tRNA-Lys-CTT-2-2)
  12. Branchiostoma floridae tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 12)
  13. Callipepla squamata tRNA
  14. Callithrix jacchus tRNA-Lys (CTT) (tRNA-Lys-CTT-1-1, tRNA-Lys-CTT-1-2)
  15. Callorhinchus milii tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1)
  16. Calypte anna (Anna's hummingbird) tRNA
  17. Camelus ferus tRNA
  18. Canis lupus familiaris tRNA-Lys (CTT) (tRNA-Lys-CTT-4-1, tRNA-Lys-CTT-4-2)
  19. Carlito syrichta tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1)
  20. Cataglyphis hispanica (Desert ant) transfer RNA lysine (anticodon CUU)
  21. Cavia porcellus tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1)
  22. Ceratotherium simum simum tRNA-Lys (CTT) (tRNA-Lys-CTT-5-1, tRNA-Lys-CTT-5-2)
  23. Chaetura pelagica (chimney swift) tRNA
  24. Chelonia mydas tRNA
  25. Chelydra serpentina (Common snapping turtle) tRNA-Lys
  26. Chlamydotis macqueenii tRNA
  27. Chlorocebus sabaeus tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1, tRNA-Lys-CTT-2-2)
  28. Chrysemys picta bellii tRNA-Lys (CTT) (tRNA-Lys-CTT-3-1, tRNA-Lys-CTT-3-2)
  29. Colinus virginianus (northern bobwhite) tRNA
  30. Columba livia (Rock pigeon) tRNA
  31. Cricetulus griseus tRNA-Lys (CTT) (tRNA-Lys-CTT-3-1, tRNA-Lys-CTT-3-2)
  32. Cuculus canorus (common cuckoo) tRNA
  33. Dasypus novemcinctus tRNA-Lys (CTT) (tRNA-Lys-CTT-7-1, tRNA-Lys-CTT-7-2)
  34. Dipodomys ordii tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1, tRNA-Lys-CTT-2-2)
  35. Echinops telfairi tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1, tRNA-Lys-CTT-2-2)
  36. Egretta garzetta tRNA
  37. Eptesicus nilssonii tRNA-Lys
  38. Equus caballus tRNA-Lys (CTT) (tRNA-Lys-CTT-4-1, tRNA-Lys-CTT-4-2)
  39. Felis catus tRNA-Lys (CTT) (tRNA-Lys-CTT-5-1, tRNA-Lys-CTT-5-2)
  40. Ficedula albicollis tRNA
  41. Fukomys damarensis tRNA
  42. Gallus gallus tRNA-Lys (CTT) (tRNA-Lys-CTT-1-1, tRNA-Lys-CTT-1-2)
  43. Gigantopelta aegis tRNA-Lys
  44. Gorilla gorilla gorilla tRNA-Lys (CTT) (tRNA-Lys-CTT-1-1, tRNA-Lys-CTT-1-2)
  45. Heterocephalus glaber tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1)
  46. Homo sapiens tRNA-Lys (anticodon CTT) 1-1 (TRK-CTT1-1, TRK-CTT1-2)
  47. Ictidomys tridecemlineatus tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1, tRNA-Lys-CTT-2-2)
  48. Lamprotornis superbus tRNA-OTHER
  49. Latimeria chalumnae tRNA-Lys (CTT) (tRNA-Lys-CTT-2 1 to 5)
  50. Leptosomus discolor tRNA
  51. Lineus longissimus (Bootlace worm) misc RNA ENSLLNG00015024963.1
  52. Lonchura striata domestica tRNA
  53. Loxodonta africana tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1, tRNA-Lys-CTT-2-2)
  54. Lupinus angustifolius (narrow-leaved blue lupine) tRNA
  55. Macaca mulatta tRNA-Lys (CTT) (tRNA-Lys-CTT-10-1, tRNA-Lys-CTT-10-2)
  56. Manacus vitellinus (golden-collared manakin) tRNA
  57. Marmota monax (woodchuck) tRNA.Lys
  58. Meleagris gallopavo tRNA-Lys (CTT) (tRNA-Lys-CTT-2 1 to 3)
  59. Melopsittacus undulatus tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1)
  60. Mesocricetus auratus tRNA
  61. Microcebus murinus tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1)
  62. Monodelphis domestica tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1, tRNA-Lys-CTT-2-2)
  63. Mus caroli tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1, tRNA-Lys-CTT-2-2)
  64. Mus musculus castaneus tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1, tRNA-Lys-CTT-2-2)
  65. Mus musculus domesticus tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1)
  66. Mus musculus musculus tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1, tRNA-Lys-CTT-2-2)
  67. Mus musculus tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1, tRNA-Lys-CTT-2-2)
  68. Mus pahari tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1, tRNA-Lys-CTT-2-2)
  69. Mus spretus tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1, tRNA-Lys-CTT-2-2)
  70. Mustela putorius furo tRNA-Lys (CTT) (tRNA-Lys-CTT-3-1)
  71. Myotis brandtii tRNA
  72. Myotis davidii tRNA
  73. Myotis lucifugus tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1, tRNA-Lys-CTT-2-2)
  74. Nematostella vectensis (Starlet sea anemone) tRNA-Lys for anticodon CUU
  75. Neotoma lepida (desert woodrat) tRNA
  76. Nipponia nippon tRNA
  77. Nomascus leucogenys tRNA-Lys (CTT) (tRNA-Lys-CTT-1-1, tRNA-Lys-CTT-1-2)
  78. Notamacropus eugenii tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1, tRNA-Lys-CTT-2-2)
  79. Ochotona princeps tRNA-Lys (CTT) (tRNA-Lys-CTT-3-1, tRNA-Lys-CTT-3-2)
  80. Ophiophagus hannah tRNA
  81. Ornithorhynchus anatinus tRNA-Lys (CTT) (tRNA-Lys-CTT-2 1 to 3)
  82. Oryctolagus cuniculus tRNA-Lys (CTT) (tRNA-Lys-CTT-2 1 to 3)
  83. Oryza brachyantha (malo sina) tRNA-Lys for anticodon CUU
  84. Otolemur garnettii tRNA-Lys (CTT) (tRNA-Lys-CTT-3-1, tRNA-Lys-CTT-3-2)
  85. Ovis aries tRNA-Lys (CTT) (tRNA-Lys-CTT-4-1, tRNA-Lys-CTT-4-2)
  86. Pan troglodytes tRNA-Lys (CTT) (tRNA-Lys-CTT-1-1, tRNA-Lys-CTT-1-2)
  87. Papio anubis tRNA-Lys (CTT) (tRNA-Lys-CTT-1-1, tRNA-Lys-CTT-1-2)
  88. Patagioenas fasciata monilis tRNA
  89. Pelecanus crispus tRNA
  90. Pelodiscus sinensis tRNA
  91. Phaseolus vulgaris tRNA-Lys for anticodon CUU
  92. Dryobates pubescens tRNA
  93. Podarcis lilfordi tRNA.Lys
  94. Pollicipes pollicipes tRNA-Lys
  95. Pongo abelii tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1, tRNA-Lys-CTT-2-2)
  96. Procavia capensis tRNA-Lys (CTT) (tRNA-Lys-CTT-4-1, tRNA-Lys-CTT-4-2)
  97. Pterocles gutturalis (yellow-throated sandgrouse) tRNA
  98. Pteropus alecto tRNA
  99. Pygoscelis adeliae tRNA
  100. Rattus norvegicus tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1, tRNA-Lys-CTT-2-2)
  101. Saccoglossus kowalevskii (Acorn worm) tRNA-Lys
  102. Saimiri boliviensis boliviensis tRNA-Lys (CTT) (tRNA-Lys-CTT-1-1, tRNA-Lys-CTT-1-2)
  103. Sarcophilus harrisii tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1, tRNA-Lys-CTT-2-2)
  104. Sorex araneus tRNA-Lys (CTT) (tRNA-Lys-CTT-2-1)
  105. Sphaerodactylus townsendi tRNA-Lys
  106. Sus scrofa tRNA-Lys (CTT) (tRNA-Lys-CTT-4-1, tRNA-Lys-CTT-4-2)
  107. Taeniopygia guttata tRNA-Lys (CTT) (tRNA-Lys-CTT-1-1, tRNA-Lys-CTT-1-2)
  108. Thrips palmi (Melon Thrips) tRNA-Lys
  109. Trichechus manatus latirostris tRNA-Lys (CTT) (tRNA-Lys-CTT-3-1, tRNA-Lys-CTT-3-2)
  110. Tupaia chinensis (Chinese tree shrew) tRNA
  111. Tursiops truncatus tRNA-Lys (CTT) (tRNA-Lys-CTT-3-1)
  112. Vicugna pacos tRNA-Lys (CTT) (tRNA-Lys-CTT-4-1, tRNA-Lys-CTT-4-2)
2D structure Publications