Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gadus morhua (Atlantic cod) gmo-miR-217-5p URS00004D9322_8049

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACUGCAUCAGGAACUGAUUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Alligator mississippiensis (American alligator) ami-miR-217-5p
  2. Anolis carolinensis aca-miR-217-5p
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-217
  4. Callorhinchus milii (elephant shark) eshark_mir-217_1
  5. Chrysemys picta (Painted turtle) cpi-miR-217-5p
  6. Danio rerio (zebrafish) dre-miR-217
  7. Ictalurus punctatus (channel catfish) ipu-miR-217
  8. Takifugu rubripes fru-miR-217
  9. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-217
  10. Tor tambroides miR-217