Theropithecus gelada (gelada) Small nucleolar RNA SNORD62 (ENSTGEG00000014594.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Theropithecus gelada (gelada) Small nucleolar RNA SNORD62 (ENSTGEG00000014594.1) URS00004D7B5D_9565

86 nucleotides
1 database (Ensembl)
Found in 14 other species
10 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UCUCAGUGAUGUAAUUCCAAUAGAUCCUUCUGACCCUCCACUGUGGACUCAAUAGCAGGGAGAUGAAGAGGACAGUGACUGAGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

Cercocebus atys Small nucleolar RNA SNORD62 (ENSCATG00000002933.1)
Colobus angolensis palliatus (Angola colobus) Small nucleolar RNA SNORD62 (ENSCANG00000008519.1)
Gorilla gorilla gorilla (Western Lowland Gorilla) Small nucleolar RNA SNORD62 (ENSGGOG00000041487.1)
Homo sapiens small nucleolar RNA, C/D box 62A (SNORD62A, SNORD62B)
Macaca fascicularis Small nucleolar RNA SNORD62 (ENSMFAG00000061304.1)
Macaca mulatta Small nucleolar RNA SNORD62 (ENSMMUG00000059098.1)
Macaca nemestrina Small nucleolar RNA SNORD62 (ENSMNEG00000011658.1)
Pan paniscus Small nucleolar RNA SNORD62 (ENSPPAG00000006052.1)
Pan troglodytes Small nucleolar RNA SNORD62 (ENSPTRG00000045107.1)
Papio anubis Small nucleolar RNA SNORD62 (ENSPANG00000046778.1)
Piliocolobus tephrosceles (Ugandan red Colobus) Small nucleolar RNA SNORD62 (ENSPTEG00000039171.1)
Pongo abelii (Sumatran orangutan) Small nucleolar RNA SNORD62 (ENSPPYG00000035533.1)
Rhinopithecus bieti Small nucleolar RNA SNORD62 (ENSRBIG00000008514.1)
Rhinopithecus roxellana (Golden snub-nosed monkey) Small nucleolar RNA SNORD62 (ENSRROG00000002508.1)

2D structure

Publications