Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pongo abelii (Sumatran orangutan) microRNA mir-154 secondary structure diagram

Pongo abelii (Sumatran orangutan) microRNA mir-154 URS00004D42DB_9601

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUACUCGGGGAGAGGUUACCCGAGCAACUUUGCAUCUGGACGACGAAUGUUGCUCGGUGAACCCCUUUUCGGUAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Ailuropoda melanoleuca (giant panda) mir-154
  2. Chlorocebus sabaeus microRNA mir-154
  3. Equus caballus (horse) microRNA mir-154
  4. Gorilla gorilla gorilla (western lowland gorilla) microRNA mir-154
  5. Homo sapiens microRNA mir-154
  6. Macaca mulatta (Rhesus monkey) microRNA mir-154
  7. Mustela putorius furo microRNA mir-154
  8. Nomascus leucogenys microRNA mir-154
  9. Otolemur garnettii (small-eared galago) microRNA mir-154
  10. Pan troglodytes microRNA mir-154
  11. Papio anubis microRNA mir-154
  12. Pteropus alecto microRNA mir-154
2D structure Publications