v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis thaliana (thale cress) ath-miR159b-3p URS00004D2E37_3702

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ath-miR159b-3p: Ath-mir159b-3p, a member of the miR159 family, exhibits a high degree in constructed interaction networks [PMC8080638]. The miR159 family, including ath-mir159b-3p, has been demonstrated to respond to various environmental stresses, indicating its potential involvement in stress response [PMC8080638]. Under heat stress conditions, ath-mir159b-3p was significantly induced [PMC6651063]. Furthermore, ath-mir159b-3p has been identified in extracellular vesicles isolated from broccoli flower heads [PMC10053153]. The high degree of ath-mir159b-3p in interaction networks suggests its central position and potential importance in regulatory processes [PMC8080638].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUUGGAUUGAAGGGAGCUCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Ananas comosus (pineapple) microRNA 159b
  2. Arabidopsis lyrata (lyrate rockcress) aly-miR159b-3p
  3. Camelina sativa (false flax) cas-miR159c-3p
  4. Cynara cardunculus var. scolymus cca-miR159b
  5. Linum usitatissimum lus-miR159c
  6. Nicotiana attenuata microRNA mir-159-like
  7. Pachycladon cheesemanii Pch-miR159b
  8. Pachycladon fastigiatum Pfa-miR159b
 Publications