Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Lepisosteus oculatus (spotted gar) Loc-Mir-2188_5p (mature (guide)) URS00004CF6E6_7918

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGGUCCAACCUCACAUGUCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Alligator mississippiensis Ami-Mir-2188_5p (mature (guide))
  2. Chrysemys picta bellii Cpi-Mir-2188_5p (mature (guide))
  3. Chrysemys picta (Painted turtle) cpi-miR-2188-5p
  4. Columba livia (rock pigeon) Cli-Mir-2188_5p (mature (guide))
  5. Danio rerio Dre-Mir-2188_5p (mature (guide))
  6. Gadus morhua gmo-miR-2188-5p
  7. Gallus gallus gga-miR-2188-5p
  8. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-2188
  9. Latimeria chalumnae (coelacanth) Lch-Mir-2188_5p (mature (guide))
  10. Maylandia zebra mze-miR-2188
  11. Microcaecilia unicolor Mun-Mir-2188_5p (mature (guide))
  12. Monopterus albus (swamp eel) Mal-Mir-2188_5p (mature (guide))
  13. Neolamprologus brichardi (lyretail cichlid) nbr-miR-2188
  14. Oreochromis niloticus oni-miR-2188
  15. Pundamilia nyererei pny-miR-2188
  16. Salmo salar ssa-miR-2188-5p
  17. Sphenodon punctatus Spt-Mir-2188_5p (mature (guide))
  18. Taeniopygia guttata (zebra finch) tgu-miR-2188-5p
  19. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-2188_5p (mature (guide))