Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Limulus polyphemus (Atlantic horseshoe crab) tRNA-Gln secondary structure diagram

Limulus polyphemus (Atlantic horseshoe crab) tRNA-Gln URS00004C8879_6850

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUCCAUGGUGUAAUGGUUAGCACUCUGGACUUUGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUGGAACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 118 other species

  1. Acanthoscelides obtectus hypothetical protein
  2. Acyrthosiphon pisum (Pea aphid) tRNA-Gln
  3. Adelges cooleyi (Spruce gall adelgid) transfer RNA glutamine (anticodon UUG)
  4. Aethina tumida (Small hive beetle) transfer RNA glutamine (anticodon UUG)
  5. Agrilus planipennis tRNA-Gln
  6. Alosa alosa (allis shad) tRNA-Gln
  7. Amyelois transitella tRNA-Gln
  8. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000003625.1
  9. Anolis carolinensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  10. Anthonomus grandis grandis (Boll weevil) transfer RNA glutamine (anticodon UUG)
  11. Apis dorsata (Giant honeybee) tRNA-Gln
  12. Apis florea (Dwarf honeybee) tRNA-Gln
  13. Apis mellifera tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  14. Araneus ventricosus tRNA-Gln
  15. Aromia moschata tRNA-Gln
  16. Bicyclus anynana (Squinting bush brown) tRNA-Gln
  17. Biomphalaria glabrata (Bloodfluke planorb) tRNA tRNA-Gln
  18. Biomphalaria pfeifferi tRNA-Gln
  19. Bombus huntii (Hunt's bumblebee) transfer RNA glutamine (anticodon UUG)
  20. Bombus terrestris tRNA LOC110120295
  21. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Gln
  22. Bombyx mandarina (Wild silkworm) tRNA-Gln
  23. Bombyx mori tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 5)
  24. Caerostris darwini tRNA-Gln
  25. Caerostris extrusa tRNA-Gln
  26. Caligus rogercresseyi tRNA-Gln
  27. Callosobruchus analis hypothetical protein
  28. Callosobruchus chinensis (azuki bean weevil) hypothetical protein
  29. Cinara cedri tRNA.Gln
  30. Cordylochernes scorpioides tRNA-Gln
  31. Crassostrea angulata (Portuguese oyster) transfer RNA glutamine (anticodon UUG)
  32. Crassostrea gigas tRNA-Gln for anticodon UUG
  33. Crassostrea virginica (Eastern oyster) tRNA-Gln
  34. Daktulosphaira vitifoliae (Grape phylloxera) transfer RNA glutamine (anticodon UUG)
  35. Danaus plexippus plexippus tRNA
  36. Dendroctonus ponderosae (Mountain pine beetle) tRNA-Gln
  37. Diabrotica virgifera virgifera transfer RNA glutamine (anticodon UUG)
  38. Dryococelus australis tRNA-OTHER
  39. Dufourea novaeangliae (Bee) tRNA-Gln
  40. Eufriesea mexicana (Bee) tRNA-Gln
  41. Eumeta japonica tRNA-Gln
  42. Exocentrus adspersus tRNA-Gln
  43. Frieseomelitta varia (marmelada) tRNA-Gln
  44. Galendromus occidentalis (Western predatory mite) tRNA-Gln
  45. Galleria mellonella (Greater wax moth) tRNA-Gln
  46. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014487.1
  47. Harpegnathos saltator tRNA-Gln
  48. Heliconius melpomene tRNA HMEL004786
  49. Helicoverpa armigera (Cotton bollworm) transfer RNA glutamine (anticodon UUG)
  50. Helicoverpa zea (Corn earworm) tRNA-Gln
  51. Homalodisca vitripennis (Glassy winged sharpshooter) tRNA-Gln
  52. Homo sapiens (human) tRNA-Gln (UUG)
  53. Larimichthys crocea tRNA
  54. Leguminivora glycinivorella tRNA-Gln
  55. Lepisosteus oculatus tRNA
  56. Leptinotarsa decemlineata (Colorado potato beetle) tRNA-Gln
  57. Leptotrombidium deliense (Harvest mite) tRNA-Gln for anticodon UUG
  58. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015014953.1
  59. Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005015824.1
  60. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005015829.1
  61. Limnoperna fortunei (Golden mussle) misc RNA ENSLFOG00000068249.1
  62. Lineus longissimus (Bootlace worm) misc RNA ENSLLNG00015025989.1
  63. Lingula anatina (Lamp shell) tRNA-Gln
  64. Lutzomyia longipalpis tRNA tRNA-Gln
  65. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA glutamine (anticodon UUG)
  66. Manduca sexta tRNA-Gln
  67. Megachile rotundata tRNA-Gln
  68. Melipona bicolor tRNA-Gln
  69. Melipona quadrifasciata tRNA
  70. Melitaea cinxia (Glanville fritillary) misc RNA ENSMCXG00005023569.1
  71. Molorchus minor tRNA-Gln
  72. Monomorium pharaonis (Pharaoh ant) tRNA-Gln
  73. Mytilus galloprovincialis (Mediterranean mussel) tRNA
  74. Nephila pilipes (giant wood spider) tRNA-Gln
  75. Onthophagus taurus tRNA-Gln
  76. Operophtera brumata tRNA
  77. Ophiophagus hannah tRNA
  78. Ornithorhynchus anatinus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  79. Oryctes borbonicus tRNA
  80. Oryzias latipes tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  81. Ostrea edulis (European flat oyster) transfer RNA glutamine (anticodon UUG)
  82. Pangasianodon gigas (Mekong giant catfish) tRNA-Gln
  83. Pangasianodon hypophthalmus tRNA-Gln
  84. Papilio machaon tRNA
  85. Papilio xuthus tRNA
  86. Pararge aegeria tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 5)
  87. Parasteatoda tepidariorum (Common house spider) tRNA-Gln
  88. Pectinophora gossypiella transfer RNA glutamine (anticodon UUG)
  89. Pediculus humanus corporis (Human body louse) tRNA tRNA-Gln
  90. Pelobates cultripes (western spadefoot toad) tRNA.Gln
  91. Phlebotomus papatasi tRNA tRNA-Gln
  92. Plutella xylostella tRNA-Gln
  93. Podarcis lilfordi tRNA.Gln
  94. Pogonomyrmex barbatus tRNA-Gln
  95. Polistes dominula tRNA-Gln
  96. Polistes fuscatus (Common paper wasp) tRNA-Gln
  97. Pomacea canaliculata (Apple snail) tRNA-Gln
  98. Potamilus streckersoni tRNA-Gln
  99. Priapulus caudatus (Penis worm) tRNA-Gln
  100. Rhamnusium bicolor tRNA-Gln
  101. Rhopalosiphum maidis (Corn leaf aphid) tRNA-Gln
  102. Sipha flava tRNA-Gln
  103. Sitophilus oryzae tRNA-Gln
  104. Sphaerodactylus townsendi tRNA-Gln
  105. Spodoptera frugiperda tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 5)
  106. Stegodyphus dumicola tRNA-Gln
  107. Stegodyphus mimosarum (African social velvet spider) tRNA-Gln for anticodon UUG
  108. Tribolium castaneum tRNA-Gln for anticodon UUG
  109. Trichogramma pretiosum tRNA-Gln
  110. Trichonephila clavata tRNA-Gln
  111. Trichonephila clavipes tRNA-Gln
  112. Trichonephila inaurata madagascariensis (Nephila madagascariensis) tRNA-Gln
  113. Tropilaelaps mercedesae tRNA
  114. Varroa destructor (Honeybee mite) tRNA-Gln
  115. Varroa jacobsoni (Varroa mite) tRNA-Gln
  116. Xenopus laevis (African clawed frog) tRNA
  117. Xenopus tropicalis tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 17)
  118. Zerene cesonia tRNA-Gln
2D structure