Tupaia chinensis (Chinese tree shrew) tRNA

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tupaia chinensis (Chinese tree shrew) tRNA URS00004BF687_246437

71 nucleotides
1 database (Rfam)
Found in 6 other species
56 publications
1. sncRNA
2. tRNA
3. glycyl tRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GCAUUGGUGGUUCAGUGGUAGAAUUCUCGCCUCCCACGCGGGAGACCCGGGUUCAAUUCCCGGCCAAUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Erinaceus europaeus tRNA-Gly (CCC) (tRNA-Gly-CCC-2-1, tRNA-Gly-CCC-2-2)
Gorilla gorilla gorilla tRNA-Gly (CCC) (tRNA-Gly-CCC-1 1 to 3)
Homo sapiens tRNA-Gly (anticodon CCC) 1-1 (TRG-CCC1-1, TRG-CCC1-2)
Nomascus leucogenys tRNA-Gly (CCC) (tRNA-Gly-CCC-2-1)
Pan troglodytes tRNA-Gly (CCC) (tRNA-Gly-CCC-2-1, tRNA-Gly-CCC-5-1, tRNA-Gly-CCC-7-1)
Pongo abelii tRNA-Gly (CCC) (tRNA-Gly-CCC-4-1)

2D structure

Publications