Brassica rapa (field mustard) bra-miR168b-3p URS00004B4991_3711

• 21 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 11 other species
• 61 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

CCCGCCUUGCAUCAACUGAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

1. Arabidopsis lyrata (lyrate rockcress) aly-miR168a-3p
2. Arabidopsis thaliana (thale cress) ath-miR168a-3p
3. Camelina sativa cas-miR168
4. Citrus sinensis csi-miR168-3p
5. Cynara cardunculus var. scolymus cca-miR168b
6. Fragaria vesca subsp. vesca fve-miR168-3p
7. Medicago truncatula (barrel medic) mtr-miR168c-3p
8. Populus tomentosa Pto-miR168b-3p
9. Populus trichocarpa ptc-miR168a-3p
10. Prunus persica (peach) microRNA miRNA_366
11. Solanum lycopersicum sly-miR168b-3p

Publications Download

• FASTA
• JSON