Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA, Ro60-associated Y5 (RNY5) secondary structure diagram

Homo sapiens (human) RNA, Ro60-associated Y5 (RNY5) URS00004A2461_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RNY5: RNY5 is a highly conserved human YRNA that is known to contain a 5' end 8 nt motif (GUAGUGGG) and a 3' end 9 nt motif (CCCACUGCU) [PMC8973356]. It is the most abundant miscRNA gene present in extracellular vesicles (EVs), composing a significant proportion of sRNAs in both BJ EVs (35%) and K562 EVs (48%) [PMC4604435]. Interestingly, the decrease in RNY5 expression in EVs was not accompanied by an increase in the number of full-length RNY5 reads [PMC7430647]. This suggests that there may be alternative processing or degradation mechanisms affecting RNY5 within EVs. Furthermore, experiments have shown that mutations in RNY5 can lead to changes in its internal loops and stem domains [PMC8973356]. Overall, these findings highlight the importance of RNY5 as a highly abundant YRNA present in EVs and suggest that it may have functional roles beyond its known involvement in DNA replication initiation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUUGGUCCGAGUGUUGUGGGUUAUUGUUAAGUUGAUUUAACAUUGUCUCCCCCCACAACCGCGCUUGACUAGCUUGCUGUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications