Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72442 URS000049EDFD_10090

• 22 nucleotides
• 2 databases (ENA, PirBase)
• Found in 4 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. piRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UGUAAACAUCCUACACUCUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

1. Danio rerio (zebrafish) dre-miR-30c-5p
2. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62876
3. Tor tambroides miR-30c-5p
4. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-992532

Download

• FASTA
• JSON