Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bradyrhizobium japonicum USDA 6 transfer-messenger RNA Brady_japon_USD6 URS000048A91D_1037409

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGGCGAAAUAGGAUCGACGAGGGCGUAAAGGGCGUGCUUUUUCCCGGUAUUGUUCCGCCGUUAUCGGGCUACUGCAAUAGUUGCCAACGACAACUUUGCUCCGGUUGCUCAGGCUGCGUAACGCAGUUUGAAAGACCAUCUUAAAGUCCUAACGGGUUAAGCUCCGUUAGGCGGGGUUCGGAGGCACCUGGCAACAGAAGCCUCCACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Bradyrhizobium diazoefficiens transfer-messenger RNA Brady_japon
  2. Bradyrhizobium diazoefficiens USDA 110 transfer-messenger RNA Brady_japon
  3. Bradyrhizobium japonicum CCBAU 15618 transfer-messenger RNA Brady_japon_USD6
  4. Bradyrhizobium japonicum CCBAU 25435 transfer-messenger RNA Brady_japon_USD6
  5. Bradyrhizobium japonicum transfer-messenger RNA Brady_japon