Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 41 (SNORA41) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 41 (SNORA41) URS0000488BFE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA41: SNORA41 is a small nucleolar RNA (snoRNA) that has been found to be up-regulated in certain conditions [PMC3868548]. In a study comparing gene expression in different groups, it was observed that SNORA41 was up-regulated in the OBNS/PS-GFP-hNGF group, but not in the OBNS/PC-GFP group [PMC3868548]. Another study found that downregulation of SNORA41 was associated with good cancer prognosis [PMC5494892]. In the mammary glands of offspring, downregulation of SNORA41 was linked to reduced cancer risk [PMC5494892]. SNORA41 has also been identified as one of the snoRNAs that may be involved in carcinogenesis and tumor progression [PMC8806983]. In a study on non-small cell lung carcinoma, increased expression of SNORA41 was observed and it was found to be detectable at higher levels in plasma samples from NSCLC patients compared to healthy controls or COPD patients [PMC4913179]. The specific primers used for detecting SNORA41 were mentioned as: forward primer 5′-AGCTGTCTTTATGGTAGCAGT-3′ and reverse primer 5′-GTGTTTCTAGGATGCTCTGGT-3′ [PMC5780441].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCACAGCUACUGGUCUGCAGCUGUUCUUAUGGUAGCAGUUGUGGCAUUCCUCUGUGGGAAAGAAACUGUUAACACAAACACCUCUUUCUUAGCAAAACAGAAAGUGGGUAUAUAUGUGUGACAGACACAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

2D structure Publications