Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 41 (SNORA41) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 41 (SNORA41) URS0000488BFE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

snora41: SNORA41 is a small nucleolar RNA (snoRNA) of the H/ACA box class, which is involved in the chemical modification of other RNAs, particularly ribosomal RNAs [PMC9110153]. It was found to be up-regulated in olfactory bulb neural stem cells (OBNS) treated with a green fluorescent protein-human nerve growth factor (GFP-hNGF) construct, suggesting a role in neural gene expression [PMC3868548]. SNORA41 expression was down-regulated in the mammary glands of offspring from dams fed a control diet, which was associated with reduced cancer risk and improved immune functions [PMC5494892]. Contrary to downregulation in chronic enteritis, SNORA41 may actually be involved in promoting carcinogenesis and cancer progression [PMC8806983]. In non-small cell lung carcinoma (NSCLC), SNORA41 was among the snoRNAs that were overexpressed and detectable at significantly higher levels in patients' plasma compared to healthy controls or chronic obstructive pulmonary disease (COPD) patients [PMC4913179]. These findings highlight SNORA41's potential as a biomarker for cancer prognosis and its involvement in gene expression modulation related to neural development and immune functions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCACAGCUACUGGUCUGCAGCUGUUCUUAUGGUAGCAGUUGUGGCAUUCCUCUGUGGGAAAGAAACUGUUAACACAAACACCUCUUUCUUAGCAAAACAGAAAGUGGGUAUAUAUGUGUGACAGACACAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression Publications