v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cochliomyia hominivorax (primary screw-worm) mature cho-miR-375 URS0000484F8B_115425

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUUGUUCGUUUGGCUUAAGUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Bactrocera dorsalis (oriental fruit fly) bdo-miR-375
  2. Cochliomyia macellaria mature cma-miR-375
  3. Drosophila ananassae Dan-Mir-375_3p (mature (guide))
  4. Drosophila melanogaster dme-miR-375-3p
  5. Drosophila mojavensis Dmo-Mir-375_3p (mature (guide))
  6. Drosophila pseudoobscura dps-miR-375-3p
  7. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0331095_df_nrg
  8. Drosophila simulans dsi-miR-375-3p
  9. Drosophila yakuba Dya-Mir-375_3p (mature (guide))